Incidental Mutation 'R6626:Bcl9'
ID524790
Institutional Source Beutler Lab
Gene Symbol Bcl9
Ensembl Gene ENSMUSG00000038256
Gene NameB cell CLL/lymphoma 9
Synonyms8030475K17Rik, A330041G23Rik, 2610202E01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.934) question?
Stock #R6626 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location97203662-97297917 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 97215396 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Histidine at position 29 (R29H)
Ref Sequence ENSEMBL: ENSMUSP00000131692 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000046521] [ENSMUST00000166341]
Predicted Effect probably benign
Transcript: ENSMUST00000046521
AA Change: R29H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000046152
Gene: ENSMUSG00000038256
AA Change: R29H

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
PDB:2VP7|B 174 205 4e-13 PDB
low complexity region 229 247 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 321 342 N/A INTRINSIC
Pfam:BCL9 350 389 3.1e-24 PFAM
low complexity region 481 494 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 985 1001 N/A INTRINSIC
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
low complexity region 1156 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1281 1299 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132266
Predicted Effect noncoding transcript
Transcript: ENSMUST00000134695
Predicted Effect noncoding transcript
Transcript: ENSMUST00000135247
Predicted Effect noncoding transcript
Transcript: ENSMUST00000141861
Predicted Effect probably benign
Transcript: ENSMUST00000166341
AA Change: R29H

PolyPhen 2 Score 0.003 (Sensitivity: 0.98; Specificity: 0.44)
SMART Domains Protein: ENSMUSP00000131692
Gene: ENSMUSG00000038256
AA Change: R29H

DomainStartEndE-ValueType
low complexity region 49 63 N/A INTRINSIC
low complexity region 86 98 N/A INTRINSIC
low complexity region 144 157 N/A INTRINSIC
PDB:2VP7|B 174 205 4e-13 PDB
low complexity region 229 247 N/A INTRINSIC
low complexity region 255 273 N/A INTRINSIC
low complexity region 321 342 N/A INTRINSIC
Pfam:BCL9 350 388 5.2e-22 PFAM
low complexity region 481 494 N/A INTRINSIC
low complexity region 506 517 N/A INTRINSIC
low complexity region 817 835 N/A INTRINSIC
low complexity region 891 902 N/A INTRINSIC
low complexity region 985 1001 N/A INTRINSIC
low complexity region 1032 1044 N/A INTRINSIC
low complexity region 1135 1153 N/A INTRINSIC
low complexity region 1156 1177 N/A INTRINSIC
low complexity region 1257 1268 N/A INTRINSIC
low complexity region 1281 1299 N/A INTRINSIC
low complexity region 1371 1391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000196586
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 97% (36/37)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] BCL9 is associated with B-cell acute lymphoblastic leukemia. It may be a target of translocation in B-cell malignancies with abnormalities of 1q21. Its function is unknown. The overexpression of BCL9 may be of pathogenic significance in B-cell malignancies. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice carrying homozygous floxed Bcl9 and Bcl9l alleles, inactivated in muscle cells, exhibit impaired muscle regeneration due to increased apoptosis. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930556J24Rik T C 11: 3,938,056 H110R unknown Het
4932415D10Rik A G 10: 82,292,833 F1448L probably benign Het
Adgrv1 T A 13: 81,518,126 D1937V probably damaging Het
Ank1 T A 8: 22,975,191 L19H probably damaging Het
Boc A T 16: 44,520,440 I49N possibly damaging Het
C8a T C 4: 104,845,967 I298V probably benign Het
Cacna1s T C 1: 136,094,965 S879P probably damaging Het
Cacna2d3 T C 14: 29,064,186 probably benign Het
Dnm1 A G 2: 32,340,880 I63T probably damaging Het
Flnb C T 14: 7,929,012 R1914C probably damaging Het
Gm9493 A T 19: 23,619,845 K35M possibly damaging Het
Gpld1 T C 13: 24,979,970 S552P probably damaging Het
Hacd1 T A 2: 14,026,944 I243F probably benign Het
Klhdc4 A G 8: 121,820,162 V110A probably benign Het
Krt26 C T 11: 99,329,702 V441M probably benign Het
Muc6 G A 7: 141,639,559 probably benign Het
Nav2 A G 7: 49,594,352 Y2109C probably damaging Het
Ncbp3 T A 11: 73,073,384 S387T possibly damaging Het
Notch2 T G 3: 98,101,605 V513G probably damaging Het
Nt5c1b A T 12: 10,374,837 R128* probably null Het
Olfr1055 C T 2: 86,347,020 V249I possibly damaging Het
Olfr146 A G 9: 39,019,106 V145A possibly damaging Het
Olfr449 A G 6: 42,838,648 M256V probably benign Het
Olig2 T C 16: 91,227,156 S253P unknown Het
Phkb T A 8: 85,922,151 F199I probably damaging Het
Rnf17 A G 14: 56,427,924 T178A possibly damaging Het
Rsf1 CG CGACGGCGGGG 7: 97,579,908 probably benign Homo
Sfxn2 A T 19: 46,582,528 N9I possibly damaging Het
Slc16a4 G A 3: 107,301,196 A341T possibly damaging Het
Tank T A 2: 61,650,296 probably benign Het
Tnr A T 1: 159,850,252 Y69F probably damaging Het
Trp53bp1 T C 2: 121,207,803 D1518G probably damaging Het
Txndc16 T C 14: 45,161,335 probably null Het
Ugp2 A G 11: 21,331,028 Y227H probably damaging Het
Vps50 G A 6: 3,551,101 W388* probably null Het
Zfp516 T A 18: 82,988,107 D1045E probably damaging Het
Zscan10 C T 17: 23,605,857 P96S probably damaging Het
Other mutations in Bcl9
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00553:Bcl9 APN 3 97207202 missense probably damaging 1.00
IGL00817:Bcl9 APN 3 97205144 missense probably damaging 0.97
IGL01609:Bcl9 APN 3 97208975 missense probably benign 0.23
IGL02245:Bcl9 APN 3 97208693 missense probably damaging 1.00
IGL02385:Bcl9 APN 3 97209278 missense probably benign 0.01
IGL02534:Bcl9 APN 3 97215229 missense probably damaging 1.00
IGL02663:Bcl9 APN 3 97205332 missense probably damaging 1.00
IGL02705:Bcl9 APN 3 97204865 missense possibly damaging 0.94
IGL02884:Bcl9 APN 3 97210052 missense probably damaging 1.00
IGL03345:Bcl9 APN 3 97209192 missense probably benign
R0312:Bcl9 UTSW 3 97209411 missense probably benign 0.27
R0602:Bcl9 UTSW 3 97205786 missense probably benign 0.00
R0627:Bcl9 UTSW 3 97205473 missense probably damaging 1.00
R0644:Bcl9 UTSW 3 97210497 missense probably benign
R1342:Bcl9 UTSW 3 97205726 missense possibly damaging 0.93
R1836:Bcl9 UTSW 3 97205870 missense probably damaging 0.97
R1886:Bcl9 UTSW 3 97215397 missense probably benign 0.04
R1931:Bcl9 UTSW 3 97205144 missense probably damaging 0.97
R1972:Bcl9 UTSW 3 97207202 missense probably damaging 1.00
R1984:Bcl9 UTSW 3 97213734 missense probably damaging 0.98
R2119:Bcl9 UTSW 3 97208915 missense probably benign 0.04
R2924:Bcl9 UTSW 3 97209753 missense probably benign 0.00
R3081:Bcl9 UTSW 3 97205673 missense possibly damaging 0.82
R3851:Bcl9 UTSW 3 97209653 missense probably damaging 0.99
R4182:Bcl9 UTSW 3 97213683 critical splice donor site probably null
R4196:Bcl9 UTSW 3 97216368 utr 5 prime probably benign
R4209:Bcl9 UTSW 3 97209953 missense probably damaging 1.00
R5082:Bcl9 UTSW 3 97209902 missense probably damaging 0.97
R5440:Bcl9 UTSW 3 97210565 missense probably benign
R5770:Bcl9 UTSW 3 97215175 missense probably benign
R5863:Bcl9 UTSW 3 97210350 missense probably benign
R5891:Bcl9 UTSW 3 97208888 missense probably damaging 1.00
R6086:Bcl9 UTSW 3 97205524 missense possibly damaging 0.73
R6305:Bcl9 UTSW 3 97205938 missense possibly damaging 0.73
R7198:Bcl9 UTSW 3 97205195 missense possibly damaging 0.87
R7198:Bcl9 UTSW 3 97208867 missense probably damaging 0.99
X0011:Bcl9 UTSW 3 97205974 missense probably benign 0.05
Z1088:Bcl9 UTSW 3 97210641 missense possibly damaging 0.50
Predicted Primers PCR Primer
(F):5'- GGAGTCGGCCGAAATACTTC -3'
(R):5'- TGGAGGCCATTCTGTTTGATCC -3'

Sequencing Primer
(F):5'- GGCACCATTTCCAGCCC -3'
(R):5'- CCTCTCTGTTGATAGCTCTAAGATGG -3'
Posted On2018-06-22