Incidental Mutation 'R6595:1700007G11Rik'
List |< first << previous [record 74 of 55675] next >> last >|
ID524853
Institutional Source Beutler Lab
Gene Symbol 1700007G11Rik
Ensembl Gene ENSMUSG00000057816
Gene NameRIKEN cDNA 1700007G11 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.142) question?
Stock #R6595 (G1)
Quality Score225.009
Status Not validated
Chromosome5
Chromosomal Location98329304-98802047 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 98801858 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 217 (D217V)
Ref Sequence ENSEMBL: ENSMUSP00000079208 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080333]
Predicted Effect possibly damaging
Transcript: ENSMUST00000080333
AA Change: D217V

PolyPhen 2 Score 0.780 (Sensitivity: 0.85; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000079208
Gene: ENSMUSG00000057816
AA Change: D217V

DomainStartEndE-ValueType
Pfam:DUF4464 12 232 7.1e-100 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000196339
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 120,394,487 Y1310F probably benign Het
Ankrd54 A G 15: 79,057,985 F148L probably damaging Het
Bag4 C T 8: 25,769,500 D224N probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk2b A T 11: 5,992,856 H126Q probably damaging Het
Camsap3 G T 8: 3,604,186 V608L probably damaging Het
Camsap3 A T 8: 3,608,742 M796L probably damaging Het
Cdh19 T C 1: 110,925,787 D308G probably benign Het
Cpsf1 T C 15: 76,602,510 I275M probably damaging Het
Cuta A G 17: 26,938,882 probably null Het
Dst T G 1: 34,250,680 L784R probably damaging Het
Fbn1 T C 2: 125,342,830 M1681V possibly damaging Het
Fbxo9 A T 9: 78,087,212 D274E probably damaging Het
Frem2 T A 3: 53,549,784 D2049V probably damaging Het
Fscn3 T C 6: 28,430,175 Y115H probably damaging Het
Glp2r G T 11: 67,764,777 D46E probably benign Het
Gm13103 T C 4: 143,852,756 C304R probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Irx5 A G 8: 92,359,619 Y110C probably damaging Het
Kdm5d T C Y: 939,829 S994P probably benign Homo
Klhl2 A T 8: 64,743,043 C555* probably null Het
Krtap4-7 A T 11: 99,643,734 I101N unknown Het
Olfr1308 A T 2: 111,960,170 V301E possibly damaging Het
Olfr60 A G 7: 140,345,647 L114P probably damaging Het
Pcdhb21 T C 18: 37,515,908 S697P probably damaging Het
Rasgrf2 A T 13: 92,030,853 H237Q probably damaging Het
Rnf216 A T 5: 143,090,657 D157E probably benign Het
Rxrg T A 1: 167,627,336 F163I probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Svopl T C 6: 38,041,067 probably null Het
Tbc1d2b G A 9: 90,226,092 P469S probably benign Het
Tecta A G 9: 42,384,227 V324A probably damaging Het
Twnk T C 19: 45,010,492 V557A probably damaging Het
Vmn2r18 G A 5: 151,562,424 T535I probably damaging Het
Zc3h14 T A 12: 98,757,026 S85T probably damaging Het
Other mutations in 1700007G11Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00775:1700007G11Rik APN 5 98784510 missense probably benign 0.00
IGL01133:1700007G11Rik APN 5 98498381 critical splice donor site probably null
IGL02151:1700007G11Rik APN 5 98329442 missense probably damaging 1.00
LCD18:1700007G11Rik UTSW 5 98707508 intron probably benign
R0962:1700007G11Rik UTSW 5 98566561 intron probably benign
R1545:1700007G11Rik UTSW 5 98329432 missense probably benign 0.25
R1886:1700007G11Rik UTSW 5 98801831 missense probably benign 0.41
R1954:1700007G11Rik UTSW 5 98566753 intron probably benign
R1965:1700007G11Rik UTSW 5 98346234 missense probably damaging 1.00
R2008:1700007G11Rik UTSW 5 98737702 missense possibly damaging 0.90
R3873:1700007G11Rik UTSW 5 98737623 missense probably damaging 1.00
R4940:1700007G11Rik UTSW 5 98737636 missense possibly damaging 0.95
R5708:1700007G11Rik UTSW 5 98737707 missense probably benign
R6509:1700007G11Rik UTSW 5 98329397 missense probably benign 0.16
Predicted Primers PCR Primer
(F):5'- TGCAATGGTCTCCATGGAAAC -3'
(R):5'- TTTGCAACCAGCCTGTGTTC -3'

Sequencing Primer
(F):5'- TCCATGGAAACGGCCCTTC -3'
(R):5'- GAAAGCAGTCCAGATTACAGTTTTC -3'
Posted On2018-06-22