Incidental Mutation 'R6595:Glp2r'
ID524886
Institutional Source Beutler Lab
Gene Symbol Glp2r
Ensembl Gene ENSMUSG00000049928
Gene Nameglucagon-like peptide 2 receptor
SynonymsGLP-2, 9530092J08Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6595 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location67661502-67771153 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 67764777 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 46 (D46E)
Ref Sequence ENSEMBL: ENSMUSP00000061560 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051765]
Predicted Effect probably benign
Transcript: ENSMUST00000051765
AA Change: D46E

PolyPhen 2 Score 0.105 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000061560
Gene: ENSMUSG00000049928
AA Change: D46E

DomainStartEndE-ValueType
signal peptide 1 26 N/A INTRINSIC
Pfam:HRM 53 122 3.4e-16 PFAM
Pfam:7tm_2 137 394 1.5e-79 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a G protein-coupled receptor that is closely related to the glucagon receptor and binds to glucagon-like peptide-2 (GLP2). Signalling through GLP2 stimulates intestinal growth and increases villus height in the small intestine, concomitant with increased crypt cell proliferation and decreased enterocyte apoptosis. [provided by RefSeq, Dec 2014]
PHENOTYPE: Mice homozygous for a null mutation display defects in Paneth cell physiology, increased small bowel bacterial loads, and increased susceptibility to small bowel injury. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,801,858 D217V possibly damaging Het
Abca15 A T 7: 120,394,487 Y1310F probably benign Het
Ankrd54 A G 15: 79,057,985 F148L probably damaging Het
Bag4 C T 8: 25,769,500 D224N probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk2b A T 11: 5,992,856 H126Q probably damaging Het
Camsap3 G T 8: 3,604,186 V608L probably damaging Het
Camsap3 A T 8: 3,608,742 M796L probably damaging Het
Cdh19 T C 1: 110,925,787 D308G probably benign Het
Cpsf1 T C 15: 76,602,510 I275M probably damaging Het
Cuta A G 17: 26,938,882 probably null Het
Dclk2 A G 3: 86,792,067 probably benign Het
Dst T G 1: 34,250,680 L784R probably damaging Het
Fbn1 T C 2: 125,342,830 M1681V possibly damaging Het
Fbxo9 A T 9: 78,087,212 D274E probably damaging Het
Frem2 T A 3: 53,549,784 D2049V probably damaging Het
Fscn3 T C 6: 28,430,175 Y115H probably damaging Het
Gm13103 T C 4: 143,852,756 C304R probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Irx5 A G 8: 92,359,619 Y110C probably damaging Het
Kdm5d T C Y: 939,829 S994P probably benign Homo
Klhl2 A T 8: 64,743,043 C555* probably null Het
Krtap4-7 A T 11: 99,643,734 I101N unknown Het
Olfr1308 A T 2: 111,960,170 V301E possibly damaging Het
Olfr60 A G 7: 140,345,647 L114P probably damaging Het
Pcdhb21 T C 18: 37,515,908 S697P probably damaging Het
Rasgrf2 A T 13: 92,030,853 H237Q probably damaging Het
Rnf216 A T 5: 143,090,657 D157E probably benign Het
Rxrg T A 1: 167,627,336 F163I probably damaging Het
Soat2 T A 15: 102,160,593 I351N probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Svopl T C 6: 38,041,067 probably null Het
Tbc1d2b G A 9: 90,226,092 P469S probably benign Het
Tbkbp1 G A 11: 97,138,752 probably benign Het
Tecta A G 9: 42,384,227 V324A probably damaging Het
Twnk T C 19: 45,010,492 V557A probably damaging Het
Vmn2r18 G A 5: 151,562,424 T535I probably damaging Het
Zc3h14 T A 12: 98,757,026 S85T probably damaging Het
Other mutations in Glp2r
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01018:Glp2r APN 11 67709644 missense probably benign
IGL02244:Glp2r APN 11 67721991 missense probably damaging 1.00
IGL02484:Glp2r APN 11 67740166 missense possibly damaging 0.90
R0013:Glp2r UTSW 11 67709712 missense possibly damaging 0.88
R0013:Glp2r UTSW 11 67709712 missense possibly damaging 0.88
R0195:Glp2r UTSW 11 67709708 missense probably damaging 0.99
R1612:Glp2r UTSW 11 67742207 missense possibly damaging 0.46
R1699:Glp2r UTSW 11 67757541 missense probably benign 0.09
R1944:Glp2r UTSW 11 67746792 missense probably benign 0.01
R3971:Glp2r UTSW 11 67746815 missense possibly damaging 0.65
R4417:Glp2r UTSW 11 67664516 intron probably benign
R4681:Glp2r UTSW 11 67730627 splice site probably null
R4914:Glp2r UTSW 11 67757593 nonsense probably null
R4918:Glp2r UTSW 11 67757593 nonsense probably null
R4938:Glp2r UTSW 11 67757593 nonsense probably null
R4940:Glp2r UTSW 11 67757593 nonsense probably null
R4941:Glp2r UTSW 11 67746703 splice site probably null
R4963:Glp2r UTSW 11 67757593 nonsense probably null
R4966:Glp2r UTSW 11 67757593 nonsense probably null
R5023:Glp2r UTSW 11 67741032 missense possibly damaging 0.82
R5121:Glp2r UTSW 11 67722100 splice site probably null
R5313:Glp2r UTSW 11 67757531 missense probably damaging 0.96
R5705:Glp2r UTSW 11 67709739 missense probably benign 0.30
R5790:Glp2r UTSW 11 67764799 missense probably damaging 1.00
R6074:Glp2r UTSW 11 67746814 missense unknown
R6910:Glp2r UTSW 11 67730671 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- CCTGTATGAAGCAAGCCAGATG -3'
(R):5'- TCTCTTTGGGGAATCTGCAG -3'

Sequencing Primer
(F):5'- GCTATATCCCAGATCTTGCAGTGTAG -3'
(R):5'- GAGTCTCACCACGTAGCTCAG -3'
Posted On2018-06-22