Incidental Mutation 'R6595:Rasgrf2'
ID 524891
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene Name RAS protein-specific guanine nucleotide-releasing factor 2
Synonyms Grf2, 6330417G04Rik
MMRRC Submission 044719-MU
Accession Numbers
Essential gene? Probably non essential (E-score: 0.191) question?
Stock # R6595 (G1)
Quality Score 225.009
Status Validated
Chromosome 13
Chromosomal Location 92028519-92268164 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to T at 92167361 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Histidine to Glutamine at position 237 (H237Q)
Ref Sequence ENSEMBL: ENSMUSP00000116203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326] [ENSMUST00000146492] [ENSMUST00000216219]
AlphaFold P70392
Predicted Effect probably damaging
Transcript: ENSMUST00000099326
AA Change: H237Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: H237Q

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146492
AA Change: H237Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116203
Gene: ENSMUSG00000021708
AA Change: H237Q

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
Pfam:RhoGEF 247 387 1.2e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000149630
AA Change: H17Q
SMART Domains Protein: ENSMUSP00000115562
Gene: ENSMUSG00000021708
AA Change: H17Q

DomainStartEndE-ValueType
Pfam:RhoGEF 28 168 4.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216219
AA Change: H237Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.5915 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Abca15 A T 7: 119,993,710 (GRCm39) Y1310F probably benign Het
Ankrd54 A G 15: 78,942,185 (GRCm39) F148L probably damaging Het
Bag4 C T 8: 26,259,528 (GRCm39) D224N probably damaging Het
Bhlhe40 TG TGG 6: 108,641,818 (GRCm39) 254 probably null Het
Camk2b A T 11: 5,942,856 (GRCm39) H126Q probably damaging Het
Camsap3 G T 8: 3,654,186 (GRCm39) V608L probably damaging Het
Camsap3 A T 8: 3,658,742 (GRCm39) M796L probably damaging Het
Cdh19 T C 1: 110,853,517 (GRCm39) D308G probably benign Het
Cfap299 A T 5: 98,949,717 (GRCm39) D217V possibly damaging Het
Cpsf1 T C 15: 76,486,710 (GRCm39) I275M probably damaging Het
Cuta A G 17: 27,157,856 (GRCm39) probably null Het
Dclk2 A G 3: 86,699,374 (GRCm39) probably benign Het
Dst T G 1: 34,289,761 (GRCm39) L784R probably damaging Het
Fbn1 T C 2: 125,184,750 (GRCm39) M1681V possibly damaging Het
Fbxo9 A T 9: 77,994,494 (GRCm39) D274E probably damaging Het
Frem2 T A 3: 53,457,205 (GRCm39) D2049V probably damaging Het
Fscn3 T C 6: 28,430,174 (GRCm39) Y115H probably damaging Het
Glp2r G T 11: 67,655,603 (GRCm39) D46E probably benign Het
Gpat2 G C 2: 127,273,838 (GRCm39) G294R possibly damaging Het
Irx5 A G 8: 93,086,247 (GRCm39) Y110C probably damaging Het
Kdm5d T C Y: 939,829 (GRCm39) S994P probably benign Homo
Klhl2 A T 8: 65,196,077 (GRCm39) C555* probably null Het
Krtap4-7 A T 11: 99,534,560 (GRCm39) I101N unknown Het
Or13a27 A G 7: 139,925,560 (GRCm39) L114P probably damaging Het
Or4f57 A T 2: 111,790,515 (GRCm39) V301E possibly damaging Het
Pcdhb21 T C 18: 37,648,961 (GRCm39) S697P probably damaging Het
Pramel27 T C 4: 143,579,326 (GRCm39) C304R probably damaging Het
Rnf216 A T 5: 143,076,412 (GRCm39) D157E probably benign Het
Rxrg T A 1: 167,454,905 (GRCm39) F163I probably damaging Het
Soat2 T A 15: 102,069,028 (GRCm39) I351N probably damaging Het
Srp72 C T 5: 77,132,047 (GRCm39) T242I probably benign Het
Svopl T C 6: 38,018,002 (GRCm39) probably null Het
Tbc1d2b G A 9: 90,108,145 (GRCm39) P469S probably benign Het
Tbkbp1 G A 11: 97,029,578 (GRCm39) probably benign Het
Tecta A G 9: 42,295,523 (GRCm39) V324A probably damaging Het
Twnk T C 19: 44,998,931 (GRCm39) V557A probably damaging Het
Vmn2r18 G A 5: 151,485,889 (GRCm39) T535I probably damaging Het
Zc3h14 T A 12: 98,723,285 (GRCm39) S85T probably damaging Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92,159,425 (GRCm39) splice site probably benign
IGL01358:Rasgrf2 APN 13 92,130,749 (GRCm39) missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92,174,718 (GRCm39) missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 92,130,857 (GRCm39) missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 92,136,145 (GRCm39) missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92,267,900 (GRCm39) missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92,167,273 (GRCm39) missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 92,131,752 (GRCm39) missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92,159,413 (GRCm39) missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 92,136,098 (GRCm39) missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 92,044,170 (GRCm39) missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 92,067,936 (GRCm39) splice site probably benign
R0632:Rasgrf2 UTSW 13 92,120,393 (GRCm39) missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 92,130,890 (GRCm39) missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92,165,174 (GRCm39) missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 92,035,808 (GRCm39) missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92,167,396 (GRCm39) missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 92,131,795 (GRCm39) missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 92,044,205 (GRCm39) missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 92,038,783 (GRCm39) missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 92,050,740 (GRCm39) missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 92,117,149 (GRCm39) missense probably benign
R1934:Rasgrf2 UTSW 13 92,131,825 (GRCm39) splice site probably null
R1990:Rasgrf2 UTSW 13 92,172,473 (GRCm39) missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 92,050,748 (GRCm39) missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92,167,351 (GRCm39) missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 92,120,374 (GRCm39) missense probably benign
R2193:Rasgrf2 UTSW 13 92,160,221 (GRCm39) splice site probably null
R2406:Rasgrf2 UTSW 13 92,120,359 (GRCm39) missense probably benign
R3055:Rasgrf2 UTSW 13 92,165,583 (GRCm39) missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92,167,296 (GRCm39) missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 92,130,974 (GRCm39) missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 92,130,773 (GRCm39) missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 92,038,717 (GRCm39) missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 92,038,796 (GRCm39) missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 92,131,797 (GRCm39) missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 92,033,773 (GRCm39) nonsense probably null
R4576:Rasgrf2 UTSW 13 92,044,529 (GRCm39) missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92,174,789 (GRCm39) missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 92,138,716 (GRCm39) critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 92,131,780 (GRCm39) missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 92,136,135 (GRCm39) missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92,160,190 (GRCm39) missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 92,044,155 (GRCm39) missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92,267,941 (GRCm39) missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 92,068,011 (GRCm39) missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92,165,609 (GRCm39) missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92,167,293 (GRCm39) missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92,267,954 (GRCm39) missense probably benign
R6428:Rasgrf2 UTSW 13 92,136,100 (GRCm39) missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92,165,027 (GRCm39) missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 92,033,754 (GRCm39) missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 92,131,732 (GRCm39) missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 92,130,952 (GRCm39) missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92,159,100 (GRCm39) intron probably benign
R7056:Rasgrf2 UTSW 13 92,167,203 (GRCm39) missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 92,034,521 (GRCm39) missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 92,032,637 (GRCm39) nonsense probably null
R7392:Rasgrf2 UTSW 13 92,041,856 (GRCm39) missense
R7469:Rasgrf2 UTSW 13 92,165,530 (GRCm39) critical splice donor site probably null
R7618:Rasgrf2 UTSW 13 92,136,085 (GRCm39) missense
R7641:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7674:Rasgrf2 UTSW 13 92,267,914 (GRCm39) missense possibly damaging 0.65
R7784:Rasgrf2 UTSW 13 92,044,201 (GRCm39) missense
R7962:Rasgrf2 UTSW 13 92,167,300 (GRCm39) missense probably damaging 0.99
R8056:Rasgrf2 UTSW 13 92,167,321 (GRCm39) missense probably damaging 0.97
R8218:Rasgrf2 UTSW 13 92,130,796 (GRCm39) missense
R8796:Rasgrf2 UTSW 13 92,038,685 (GRCm39) missense
R8913:Rasgrf2 UTSW 13 92,159,034 (GRCm39) missense probably benign 0.05
R8971:Rasgrf2 UTSW 13 92,158,225 (GRCm39) missense possibly damaging 0.80
R9020:Rasgrf2 UTSW 13 92,165,146 (GRCm39) missense possibly damaging 0.93
R9487:Rasgrf2 UTSW 13 92,267,759 (GRCm39) missense probably benign
R9562:Rasgrf2 UTSW 13 92,034,469 (GRCm39) critical splice donor site probably null
R9712:Rasgrf2 UTSW 13 92,136,092 (GRCm39) missense
R9766:Rasgrf2 UTSW 13 92,160,188 (GRCm39) missense probably damaging 1.00
R9800:Rasgrf2 UTSW 13 92,267,860 (GRCm39) missense probably damaging 0.99
X0013:Rasgrf2 UTSW 13 92,167,363 (GRCm39) missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 92,050,654 (GRCm39) missense probably damaging 0.99
Z1177:Rasgrf2 UTSW 13 92,159,081 (GRCm39) missense unknown
Z1177:Rasgrf2 UTSW 13 92,131,632 (GRCm39) missense
Predicted Primers PCR Primer
(F):5'- AAAATGCTGCTGACGTCATC -3'
(R):5'- ATTTGGGGAAAACTTGCCATTG -3'

Sequencing Primer
(F):5'- CGTCATCGTGGTTAATGGGG -3'
(R):5'- GAACGCATCATCCTAAGGGTGTC -3'
Posted On 2018-06-22