Incidental Mutation 'R6595:Rasgrf2'
ID524891
Institutional Source Beutler Lab
Gene Symbol Rasgrf2
Ensembl Gene ENSMUSG00000021708
Gene NameRAS protein-specific guanine nucleotide-releasing factor 2
SynonymsGrf2, 6330417G04Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.278) question?
Stock #R6595 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location91880400-92131656 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 92030853 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 237 (H237Q)
Ref Sequence ENSEMBL: ENSMUSP00000116203 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099326] [ENSMUST00000146492] [ENSMUST00000216219]
Predicted Effect probably damaging
Transcript: ENSMUST00000099326
AA Change: H237Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000096930
Gene: ENSMUSG00000021708
AA Change: H237Q

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
RhoGEF 247 428 2.2e-51 SMART
RasGEFN 633 775 9.35e-15 SMART
RasGEFN 786 923 6.04e-9 SMART
RasGEF 949 1186 2.97e-112 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000146492
AA Change: H237Q

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000116203
Gene: ENSMUSG00000021708
AA Change: H237Q

DomainStartEndE-ValueType
PH 23 135 1.29e-16 SMART
IQ 204 226 1.3e0 SMART
Pfam:RhoGEF 247 387 1.2e-24 PFAM
Predicted Effect unknown
Transcript: ENSMUST00000149630
AA Change: H17Q
SMART Domains Protein: ENSMUSP00000115562
Gene: ENSMUSG00000021708
AA Change: H17Q

DomainStartEndE-ValueType
Pfam:RhoGEF 28 168 4.3e-26 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000216219
AA Change: H237Q

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
Meta Mutation Damage Score 0.192 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] RAS GTPases cycle between an inactive GDP-bound state and an active GTP-bound state. This gene encodes a calcium-regulated nucleotide exchange factor activating both RAS and RAS-related protein, RAC1, through the exchange of bound GDP for GTP, thereby, coordinating the signaling of distinct mitogen-activated protein kinase pathways. [provided by RefSeq, Oct 2011]
PHENOTYPE: Mice homozygous for a targeted null mutation exhibit decreased Il2 and TNF-alpha production in stimulated T cells. Mice homozygous for mutations in both Rasgrf1 and Rasgrf2 exhibit no additional abnormalities than those observed in the Rasgrf1 mutant mice. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,801,858 D217V possibly damaging Het
Abca15 A T 7: 120,394,487 Y1310F probably benign Het
Ankrd54 A G 15: 79,057,985 F148L probably damaging Het
Bag4 C T 8: 25,769,500 D224N probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk2b A T 11: 5,992,856 H126Q probably damaging Het
Camsap3 G T 8: 3,604,186 V608L probably damaging Het
Camsap3 A T 8: 3,608,742 M796L probably damaging Het
Cdh19 T C 1: 110,925,787 D308G probably benign Het
Cpsf1 T C 15: 76,602,510 I275M probably damaging Het
Cuta A G 17: 26,938,882 probably null Het
Dclk2 A G 3: 86,792,067 probably benign Het
Dst T G 1: 34,250,680 L784R probably damaging Het
Fbn1 T C 2: 125,342,830 M1681V possibly damaging Het
Fbxo9 A T 9: 78,087,212 D274E probably damaging Het
Frem2 T A 3: 53,549,784 D2049V probably damaging Het
Fscn3 T C 6: 28,430,175 Y115H probably damaging Het
Glp2r G T 11: 67,764,777 D46E probably benign Het
Gm13103 T C 4: 143,852,756 C304R probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Irx5 A G 8: 92,359,619 Y110C probably damaging Het
Kdm5d T C Y: 939,829 S994P probably benign Homo
Klhl2 A T 8: 64,743,043 C555* probably null Het
Krtap4-7 A T 11: 99,643,734 I101N unknown Het
Olfr1308 A T 2: 111,960,170 V301E possibly damaging Het
Olfr60 A G 7: 140,345,647 L114P probably damaging Het
Pcdhb21 T C 18: 37,515,908 S697P probably damaging Het
Rnf216 A T 5: 143,090,657 D157E probably benign Het
Rxrg T A 1: 167,627,336 F163I probably damaging Het
Soat2 T A 15: 102,160,593 I351N probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Svopl T C 6: 38,041,067 probably null Het
Tbc1d2b G A 9: 90,226,092 P469S probably benign Het
Tbkbp1 G A 11: 97,138,752 probably benign Het
Tecta A G 9: 42,384,227 V324A probably damaging Het
Twnk T C 19: 45,010,492 V557A probably damaging Het
Vmn2r18 G A 5: 151,562,424 T535I probably damaging Het
Zc3h14 T A 12: 98,757,026 S85T probably damaging Het
Other mutations in Rasgrf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01308:Rasgrf2 APN 13 92022917 splice site probably benign
IGL01358:Rasgrf2 APN 13 91982630 missense probably benign 0.23
IGL01666:Rasgrf2 APN 13 92038210 missense probably damaging 1.00
IGL01930:Rasgrf2 APN 13 91982738 missense probably damaging 0.98
IGL02230:Rasgrf2 APN 13 91988026 missense probably damaging 1.00
IGL02630:Rasgrf2 APN 13 92131392 missense probably damaging 1.00
IGL02690:Rasgrf2 APN 13 92030765 missense probably damaging 1.00
IGL02943:Rasgrf2 APN 13 91983633 missense probably damaging 1.00
IGL03067:Rasgrf2 APN 13 92022905 missense probably damaging 0.97
IGL03342:Rasgrf2 APN 13 91987979 missense probably damaging 1.00
IGL03405:Rasgrf2 APN 13 91896051 missense probably damaging 1.00
R0620:Rasgrf2 UTSW 13 91919817 splice site probably benign
R0632:Rasgrf2 UTSW 13 91972274 missense probably benign 0.00
R0894:Rasgrf2 UTSW 13 91982771 missense probably damaging 1.00
R1354:Rasgrf2 UTSW 13 92028666 missense probably damaging 1.00
R1400:Rasgrf2 UTSW 13 91887689 missense probably damaging 1.00
R1437:Rasgrf2 UTSW 13 92030888 missense probably damaging 1.00
R1443:Rasgrf2 UTSW 13 91983676 missense probably damaging 1.00
R1522:Rasgrf2 UTSW 13 91896086 missense probably benign 0.00
R1553:Rasgrf2 UTSW 13 91890664 missense probably damaging 1.00
R1613:Rasgrf2 UTSW 13 91902621 missense probably damaging 1.00
R1883:Rasgrf2 UTSW 13 91969030 missense probably benign
R1934:Rasgrf2 UTSW 13 91983706 splice site probably null
R1990:Rasgrf2 UTSW 13 92035965 missense probably damaging 1.00
R2037:Rasgrf2 UTSW 13 91902629 missense probably damaging 0.99
R2043:Rasgrf2 UTSW 13 92030843 missense possibly damaging 0.91
R2135:Rasgrf2 UTSW 13 91972255 missense probably benign
R2193:Rasgrf2 UTSW 13 92023713 splice site probably null
R2406:Rasgrf2 UTSW 13 91972240 missense probably benign
R3055:Rasgrf2 UTSW 13 92029075 missense probably damaging 1.00
R3916:Rasgrf2 UTSW 13 92030788 missense probably damaging 1.00
R3954:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3955:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R3956:Rasgrf2 UTSW 13 91982855 missense probably damaging 0.98
R4133:Rasgrf2 UTSW 13 91982654 missense possibly damaging 0.59
R4177:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4178:Rasgrf2 UTSW 13 91890598 missense probably damaging 1.00
R4357:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4358:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4359:Rasgrf2 UTSW 13 91890677 missense probably damaging 1.00
R4439:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4440:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4441:Rasgrf2 UTSW 13 91983678 missense possibly damaging 0.95
R4564:Rasgrf2 UTSW 13 91885654 nonsense probably null
R4576:Rasgrf2 UTSW 13 91896410 missense possibly damaging 0.58
R4590:Rasgrf2 UTSW 13 92038281 missense probably damaging 1.00
R4718:Rasgrf2 UTSW 13 91990830 critical splice donor site probably null
R4778:Rasgrf2 UTSW 13 91983661 missense probably damaging 0.99
R4790:Rasgrf2 UTSW 13 91988016 missense probably damaging 1.00
R4808:Rasgrf2 UTSW 13 92023682 missense probably damaging 1.00
R5151:Rasgrf2 UTSW 13 91896036 missense probably damaging 1.00
R5286:Rasgrf2 UTSW 13 92131433 missense possibly damaging 0.94
R5902:Rasgrf2 UTSW 13 91919892 missense probably damaging 1.00
R6180:Rasgrf2 UTSW 13 92029101 missense probably damaging 1.00
R6264:Rasgrf2 UTSW 13 92030785 missense probably damaging 1.00
R6369:Rasgrf2 UTSW 13 92131446 missense probably benign
R6428:Rasgrf2 UTSW 13 91987981 missense probably damaging 1.00
R6619:Rasgrf2 UTSW 13 92028519 missense probably damaging 1.00
R6988:Rasgrf2 UTSW 13 91885635 missense probably benign 0.02
R7026:Rasgrf2 UTSW 13 91983613 missense probably damaging 1.00
R7038:Rasgrf2 UTSW 13 91982833 missense possibly damaging 0.95
R7045:Rasgrf2 UTSW 13 92022592 intron probably benign
R7056:Rasgrf2 UTSW 13 92030695 missense probably damaging 0.99
R7058:Rasgrf2 UTSW 13 91886402 missense probably damaging 0.99
R7256:Rasgrf2 UTSW 13 91884518 nonsense probably null
R7392:Rasgrf2 UTSW 13 91893737 missense
R7469:Rasgrf2 UTSW 13 92029022 critical splice donor site probably null
X0013:Rasgrf2 UTSW 13 92030855 missense probably damaging 1.00
X0026:Rasgrf2 UTSW 13 91902535 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- AAAATGCTGCTGACGTCATC -3'
(R):5'- ATTTGGGGAAAACTTGCCATTG -3'

Sequencing Primer
(F):5'- CGTCATCGTGGTTAATGGGG -3'
(R):5'- GAACGCATCATCCTAAGGGTGTC -3'
Posted On2018-06-22