Incidental Mutation 'R6595:Twnk'
ID524901
Institutional Source Beutler Lab
Gene Symbol Twnk
Ensembl Gene ENSMUSG00000025209
Gene Nametwinkle mtDNA helicase
Synonymstwinkle, Twinl, Peo1, D19Ertd626e
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6595 (G1)
Quality Score225.009
Status Validated
Chromosome19
Chromosomal Location45006558-45012762 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 45010492 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 557 (V557A)
Ref Sequence ENSEMBL: ENSMUSP00000026227 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000026227] [ENSMUST00000039016] [ENSMUST00000097715] [ENSMUST00000179108]
Predicted Effect probably damaging
Transcript: ENSMUST00000026227
AA Change: V557A

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000026227
Gene: ENSMUSG00000025209
AA Change: V557A

DomainStartEndE-ValueType
low complexity region 213 224 N/A INTRINSIC
Blast:TOPRIM 260 331 8e-16 BLAST
Pfam:AAA_25 377 565 5.6e-25 PFAM
Pfam:DnaB_C 390 631 6.7e-17 PFAM
Pfam:KaiC 394 628 2.6e-11 PFAM
low complexity region 650 661 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000039016
SMART Domains Protein: ENSMUSP00000045478
Gene: ENSMUSG00000035342

DomainStartEndE-ValueType
low complexity region 99 105 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 267 321 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
Pfam:Fez1 441 639 4.2e-82 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000097715
SMART Domains Protein: ENSMUSP00000095322
Gene: ENSMUSG00000025208

DomainStartEndE-ValueType
L51_S25_CI-B8 35 108 1.61e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000179108
SMART Domains Protein: ENSMUSP00000137571
Gene: ENSMUSG00000035342

DomainStartEndE-ValueType
low complexity region 99 105 N/A INTRINSIC
low complexity region 187 199 N/A INTRINSIC
low complexity region 242 265 N/A INTRINSIC
low complexity region 267 321 N/A INTRINSIC
low complexity region 375 407 N/A INTRINSIC
low complexity region 412 423 N/A INTRINSIC
Pfam:Fez1 441 639 4.2e-82 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.5%
Validation Efficiency 97% (37/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a hexameric DNA helicase which unwinds short stretches of double-stranded DNA in the 5' to 3' direction and, along with mitochondrial single-stranded DNA binding protein and mtDNA polymerase gamma, is thought to play a key role in mtDNA replication. The protein localizes to the mitochondrial matrix and mitochondrial nucleoids. Mutations in this gene cause infantile onset spinocerebellar ataxia (IOSCA) and progressive external ophthalmoplegia (PEO) and are also associated with several mitochondrial depletion syndromes. Alternative splicing results in multiple transcript variants encoding distinct isoforms.[provided by RefSeq, Aug 2009]
PHENOTYPE: Homozygous embryos display abnormal development. Embryos die around E8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700007G11Rik A T 5: 98,801,858 D217V possibly damaging Het
Abca15 A T 7: 120,394,487 Y1310F probably benign Het
Ankrd54 A G 15: 79,057,985 F148L probably damaging Het
Bag4 C T 8: 25,769,500 D224N probably damaging Het
Bhlhe40 TG TGG 6: 108,664,857 probably null Het
Camk2b A T 11: 5,992,856 H126Q probably damaging Het
Camsap3 G T 8: 3,604,186 V608L probably damaging Het
Camsap3 A T 8: 3,608,742 M796L probably damaging Het
Cdh19 T C 1: 110,925,787 D308G probably benign Het
Cpsf1 T C 15: 76,602,510 I275M probably damaging Het
Cuta A G 17: 26,938,882 probably null Het
Dclk2 A G 3: 86,792,067 probably benign Het
Dst T G 1: 34,250,680 L784R probably damaging Het
Fbn1 T C 2: 125,342,830 M1681V possibly damaging Het
Fbxo9 A T 9: 78,087,212 D274E probably damaging Het
Frem2 T A 3: 53,549,784 D2049V probably damaging Het
Fscn3 T C 6: 28,430,175 Y115H probably damaging Het
Glp2r G T 11: 67,764,777 D46E probably benign Het
Gm13103 T C 4: 143,852,756 C304R probably damaging Het
Gpat2 G C 2: 127,431,918 G294R possibly damaging Het
Irx5 A G 8: 92,359,619 Y110C probably damaging Het
Kdm5d T C Y: 939,829 S994P probably benign Homo
Klhl2 A T 8: 64,743,043 C555* probably null Het
Krtap4-7 A T 11: 99,643,734 I101N unknown Het
Olfr1308 A T 2: 111,960,170 V301E possibly damaging Het
Olfr60 A G 7: 140,345,647 L114P probably damaging Het
Pcdhb21 T C 18: 37,515,908 S697P probably damaging Het
Rasgrf2 A T 13: 92,030,853 H237Q probably damaging Het
Rnf216 A T 5: 143,090,657 D157E probably benign Het
Rxrg T A 1: 167,627,336 F163I probably damaging Het
Soat2 T A 15: 102,160,593 I351N probably damaging Het
Srp72 C T 5: 76,984,200 T242I probably benign Het
Svopl T C 6: 38,041,067 probably null Het
Tbc1d2b G A 9: 90,226,092 P469S probably benign Het
Tbkbp1 G A 11: 97,138,752 probably benign Het
Tecta A G 9: 42,384,227 V324A probably damaging Het
Vmn2r18 G A 5: 151,562,424 T535I probably damaging Het
Zc3h14 T A 12: 98,757,026 S85T probably damaging Het
Other mutations in Twnk
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00858:Twnk APN 19 45007626 missense probably benign 0.03
IGL01367:Twnk APN 19 45011651 missense possibly damaging 0.92
IGL01736:Twnk APN 19 45010188 missense probably damaging 0.97
IGL02724:Twnk APN 19 45008118 missense probably damaging 0.99
IGL03368:Twnk APN 19 45010492 missense probably damaging 0.99
R0121:Twnk UTSW 19 45009265 unclassified probably benign
R0389:Twnk UTSW 19 45008139 missense possibly damaging 0.67
R0427:Twnk UTSW 19 45007587 missense probably benign 0.00
R0443:Twnk UTSW 19 45008139 missense possibly damaging 0.67
R0501:Twnk UTSW 19 45007746 missense probably damaging 1.00
R0791:Twnk UTSW 19 45010254 unclassified probably benign
R1193:Twnk UTSW 19 45007790 missense probably damaging 1.00
R1470:Twnk UTSW 19 45009381 missense probably damaging 1.00
R1470:Twnk UTSW 19 45009381 missense probably damaging 1.00
R1487:Twnk UTSW 19 45008376 critical splice donor site probably null
R1556:Twnk UTSW 19 45009411 missense possibly damaging 0.80
R3895:Twnk UTSW 19 45007451 missense probably damaging 0.98
R5652:Twnk UTSW 19 45007293 missense possibly damaging 0.85
R6373:Twnk UTSW 19 45009381 missense probably damaging 1.00
R6880:Twnk UTSW 19 45007416 missense probably benign
R7349:Twnk UTSW 19 45010161 missense possibly damaging 0.65
R7401:Twnk UTSW 19 45011780 missense probably benign 0.15
Predicted Primers PCR Primer
(F):5'- CTTAGGTAGCGAGTGTAATGGC -3'
(R):5'- ATCCTAGGCCTCAAGGAACC -3'

Sequencing Primer
(F):5'- CGAGTGTAATGGCTGGGAC -3'
(R):5'- GGTATCCCTCACCCATGGC -3'
Posted On2018-06-22