Incidental Mutation 'R6629:Rsbn1'
ID524962
Institutional Source Beutler Lab
Gene Symbol Rsbn1
Ensembl Gene ENSMUSG00000044098
Gene Namerosbin, round spermatid basic protein 1
SynonymsC230004D03Rik, Rsbp
MMRRC Submission
Accession Numbers

Genbank: NM_172684; MGI: 2444993

Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6629 (G1)
Quality Score225.009
Status Validated
Chromosome3
Chromosomal Location103914120-103966636 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to C at 103928441 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Alanine at position 265 (D265A)
Ref Sequence ENSEMBL: ENSMUSP00000069246 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051139] [ENSMUST00000068879]
Predicted Effect probably damaging
Transcript: ENSMUST00000051139
AA Change: D265A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000058934
Gene: ENSMUSG00000044098
AA Change: D265A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 84 109 N/A INTRINSIC
low complexity region 136 151 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
low complexity region 466 477 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000068879
AA Change: D265A

PolyPhen 2 Score 0.995 (Sensitivity: 0.68; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000069246
Gene: ENSMUSG00000044098
AA Change: D265A

DomainStartEndE-ValueType
low complexity region 21 36 N/A INTRINSIC
low complexity region 49 64 N/A INTRINSIC
low complexity region 106 123 N/A INTRINSIC
low complexity region 131 156 N/A INTRINSIC
low complexity region 183 198 N/A INTRINSIC
low complexity region 252 261 N/A INTRINSIC
low complexity region 513 524 N/A INTRINSIC
Predicted Effect unknown
Transcript: ENSMUST00000151927
AA Change: D226A
SMART Domains Protein: ENSMUSP00000115693
Gene: ENSMUSG00000044098
AA Change: D226A

DomainStartEndE-ValueType
low complexity region 2 17 N/A INTRINSIC
low complexity region 59 76 N/A INTRINSIC
low complexity region 84 109 N/A INTRINSIC
low complexity region 136 151 N/A INTRINSIC
low complexity region 205 214 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000185731
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 97% (38/39)
Allele List at MGI

All alleles(9) : Targeted, other(3) Gene trapped(6)

Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
1700011I03Rik T C 18: 57,730,780 S219P possibly damaging Het
Atxn3 A T 12: 101,937,406 M180K probably benign Het
Bnip2 G T 9: 70,002,111 R236L probably null Het
Boc T C 16: 44,492,361 D582G probably benign Het
Cacul1 T C 19: 60,580,367 S118G probably benign Het
Cpa2 A T 6: 30,554,194 D271V probably damaging Het
Cubn G A 2: 13,430,872 T1091M probably damaging Het
Dlgap2 A G 8: 14,831,465 T846A probably benign Het
Eif5 G T 12: 111,543,608 A329S probably damaging Het
Fam136b-ps G A 15: 31,276,816 probably benign Het
Gnrhr A G 5: 86,182,309 V284A probably benign Het
Grin3a A G 4: 49,844,991 S31P probably damaging Het
Hectd2 T C 19: 36,615,538 L701P probably damaging Het
Hook1 C T 4: 96,001,270 T241I probably benign Het
Kif5a A G 10: 127,248,254 V52A probably damaging Het
Lasp1 T A 11: 97,806,896 Y11* probably null Het
Meltf A G 16: 31,885,076 Y207C probably damaging Het
Mllt3 ACTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT ACTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCTACTACTACTGCTGCTGCTGCTGCTGCTGCTACTGCTGCTGCTGCTGCTGCT 4: 87,841,267 probably benign Het
Nek1 A G 8: 61,054,333 probably null Het
Notch2 C A 3: 98,120,881 N969K possibly damaging Het
Olfr1221 T A 2: 89,112,162 M117L probably benign Het
Pcnx2 C T 8: 125,891,112 G135R probably benign Het
Pla2g4f A T 2: 120,308,242 L242Q probably damaging Het
Plcxd2 T G 16: 45,965,107 T312P probably damaging Het
Prpf4 G A 4: 62,417,860 V275I possibly damaging Het
Prpf8 G A 11: 75,495,426 probably null Het
Pxn T C 5: 115,554,062 L401P probably damaging Het
Rab44 A T 17: 29,135,780 probably benign Het
Rfx6 C A 10: 51,725,490 T669K probably benign Het
Rgs16 A G 1: 153,743,674 N142S probably damaging Het
Rhobtb1 A G 10: 69,270,316 E237G possibly damaging Het
Rufy4 A G 1: 74,132,367 probably null Het
Slc4a1 C A 11: 102,361,222 E19* probably null Het
Tctn1 A G 5: 122,242,668 S526P probably damaging Het
Tspear A T 10: 77,870,509 H371L probably benign Het
Vmn1r34 A T 6: 66,637,515 F80I probably benign Het
Wdr75 G A 1: 45,812,056 S264N probably damaging Het
Zfp652 A T 11: 95,763,790 N340Y probably damaging Het
Zp3 A G 5: 135,987,336 T306A probably benign Het
Other mutations in Rsbn1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00595:Rsbn1 APN 3 103928690 missense probably benign 0.01
IGL00725:Rsbn1 APN 3 103928821 missense probably damaging 0.96
IGL01682:Rsbn1 APN 3 103962380 missense probably benign 0.03
IGL01978:Rsbn1 APN 3 103961500 missense probably damaging 0.99
IGL02281:Rsbn1 APN 3 103962461 missense probably damaging 0.99
IGL02615:Rsbn1 APN 3 103953752 missense probably damaging 1.00
IGL02902:Rsbn1 APN 3 103953656 missense possibly damaging 0.62
IGL02903:Rsbn1 APN 3 103928569 missense probably damaging 1.00
IGL02927:Rsbn1 APN 3 103962352 missense probably benign
IGL03007:Rsbn1 APN 3 103928879 missense probably damaging 1.00
IGL03062:Rsbn1 APN 3 103953629 intron probably benign
IGL03345:Rsbn1 APN 3 103915150 missense possibly damaging 0.78
F2404:Rsbn1 UTSW 3 103914576 nonsense probably null
R0277:Rsbn1 UTSW 3 103914581 missense possibly damaging 0.66
R0815:Rsbn1 UTSW 3 103954153 missense probably damaging 0.98
R1760:Rsbn1 UTSW 3 103960031 missense probably damaging 1.00
R1801:Rsbn1 UTSW 3 103914872 missense probably damaging 0.97
R2021:Rsbn1 UTSW 3 103914473 missense probably benign
R2078:Rsbn1 UTSW 3 103961523 missense probably damaging 1.00
R2330:Rsbn1 UTSW 3 103914500 missense probably damaging 0.97
R3956:Rsbn1 UTSW 3 103928675 missense probably damaging 0.99
R4094:Rsbn1 UTSW 3 103928658 missense probably damaging 0.98
R4649:Rsbn1 UTSW 3 103953780 splice site probably null
R4720:Rsbn1 UTSW 3 103929020 missense possibly damaging 0.92
R5299:Rsbn1 UTSW 3 103914490 missense probably benign 0.01
R5505:Rsbn1 UTSW 3 103928943 missense probably damaging 1.00
R5699:Rsbn1 UTSW 3 103962485 missense probably benign 0.02
R5775:Rsbn1 UTSW 3 103962572 missense possibly damaging 0.80
R6509:Rsbn1 UTSW 3 103960032 missense probably damaging 1.00
R7070:Rsbn1 UTSW 3 103928983 missense probably damaging 1.00
R7116:Rsbn1 UTSW 3 103914576 nonsense probably null
Predicted Primers PCR Primer
(F):5'- GTCCATGGTCTTGCACATATTAAG -3'
(R):5'- ACCCGATATTCTTGCATGCC -3'

Sequencing Primer
(F):5'- CATGGTCTTGCACATATTAAGAAGTG -3'
(R):5'- TGCCCAAATTTAATCTGCACAGCTG -3'
Posted On2018-06-22