Incidental Mutation 'R6597:Atl2'
ID524996
Institutional Source Beutler Lab
Gene Symbol Atl2
Ensembl Gene ENSMUSG00000059811
Gene Nameatlastin GTPase 2
Synonyms2010110I21Rik, Aip-2, Arl6ip2
Accession Numbers
Is this an essential gene? Probably essential (E-score: 0.887) question?
Stock #R6597 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location79848390-79896123 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 79852766 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 293 (D293V)
Ref Sequence ENSEMBL: ENSMUSP00000108056 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000068282] [ENSMUST00000112437] [ENSMUST00000222193] [ENSMUST00000222415]
Predicted Effect possibly damaging
Transcript: ENSMUST00000068282
AA Change: D464V

PolyPhen 2 Score 0.643 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000064758
Gene: ENSMUSG00000059811
AA Change: D464V

DomainStartEndE-ValueType
low complexity region 9 22 N/A INTRINSIC
Pfam:GBP 70 341 3.9e-105 PFAM
low complexity region 377 390 N/A INTRINSIC
Blast:HAMP 495 545 4e-8 BLAST
Predicted Effect possibly damaging
Transcript: ENSMUST00000112437
AA Change: D293V

PolyPhen 2 Score 0.676 (Sensitivity: 0.86; Specificity: 0.92)
SMART Domains Protein: ENSMUSP00000108056
Gene: ENSMUSG00000059811
AA Change: D293V

DomainStartEndE-ValueType
Pfam:GBP 1 170 6.6e-69 PFAM
Pfam:GBP_C 172 302 2.7e-8 PFAM
Blast:HAMP 324 374 3e-8 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221286
Predicted Effect noncoding transcript
Transcript: ENSMUST00000221666
Predicted Effect probably benign
Transcript: ENSMUST00000222193
Predicted Effect probably benign
Transcript: ENSMUST00000222415
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223273
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.0%
  • 20x: 94.2%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 53 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
5730559C18Rik G T 1: 136,226,189 A87E probably damaging Het
A2m A G 6: 121,648,121 Y486C probably damaging Het
Asb17 A T 3: 153,844,684 T118S probably damaging Het
Bbs1 T A 19: 4,899,306 M242L probably benign Het
Btg1 T A 10: 96,618,320 S65T probably damaging Het
Cfap54 T C 10: 92,999,040 D1101G possibly damaging Het
Cmpk2 G T 12: 26,474,145 V314L possibly damaging Het
Fbxl8 A C 8: 105,268,891 D345A probably benign Het
Gys2 T A 6: 142,456,309 H268L probably benign Het
Hecw1 T A 13: 14,316,818 R117* probably null Het
Hoxd10 G A 2: 74,692,640 A221T probably benign Het
Hspa13 A T 16: 75,765,197 L38Q probably damaging Het
Ipo11 A G 13: 106,865,863 probably null Het
Itgb8 A G 12: 119,173,398 V390A possibly damaging Het
Kalrn T A 16: 34,182,747 I1370F probably damaging Het
Macf1 T C 4: 123,382,692 N6086S probably damaging Het
Ms4a13 T C 19: 11,192,939 T14A probably benign Het
Olfr1164 A G 2: 88,093,069 F289S probably damaging Het
Olfr1500 T A 19: 13,828,457 probably benign Het
Olfr204 C T 16: 59,315,350 R19H probably benign Het
Olfr545 A T 7: 102,494,421 I118N probably damaging Het
Olfr742 T A 14: 50,515,551 C116S probably benign Het
Olfr911-ps1 A T 9: 38,524,004 I91F probably benign Het
Patl2 T A 2: 122,186,164 probably benign Het
Pcdhga7 T C 18: 37,717,006 S689P probably benign Het
Pitpnc1 G T 11: 107,226,232 Y227* probably null Het
Pla2g2e T C 4: 138,880,673 V22A unknown Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prl3b1 G A 13: 27,247,974 probably null Het
Rabgef1 G A 5: 130,191,044 probably null Het
Rhot2 A T 17: 25,840,912 W341R probably damaging Het
Rps6kc1 A T 1: 190,750,184 W286R probably benign Het
Rrs1 A G 1: 9,546,376 T285A probably damaging Het
Shc3 T A 13: 51,442,973 D338V possibly damaging Het
Siglech A T 7: 55,768,463 M60L probably benign Het
Slc12a6 G T 2: 112,352,935 V756F probably damaging Het
Slc43a2 G A 11: 75,571,855 G507D probably damaging Het
Slf1 A G 13: 77,049,129 S789P probably benign Het
Spata31d1d C A 13: 59,726,057 M1221I probably benign Het
Srgap1 T C 10: 121,792,371 N899D probably benign Het
Stag1 G A 9: 100,887,420 M529I probably benign Het
Tekt3 A G 11: 63,081,259 D247G probably benign Het
Tmppe A T 9: 114,405,244 M204L probably benign Het
Tpsg1 G A 17: 25,369,297 probably benign Het
Ttn A G 2: 76,797,971 V6288A probably benign Het
Ttn A T 2: 76,893,100 probably benign Het
Twsg1 C A 17: 65,937,804 V73F probably damaging Het
Vmn2r102 A G 17: 19,694,188 T672A probably damaging Het
Vps36 A G 8: 22,202,304 I66V probably benign Het
Xrcc4 A T 13: 90,000,929 D157E probably benign Het
Zbbx T A 3: 75,136,454 Q162L probably damaging Het
Zfp560 T A 9: 20,348,001 I522L probably benign Het
Zscan20 T C 4: 128,585,746 N984S probably damaging Het
Other mutations in Atl2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02135:Atl2 APN 17 79859785 critical splice donor site probably null
IGL02692:Atl2 APN 17 79865053 missense probably benign
IGL03127:Atl2 APN 17 79852854 missense probably damaging 0.99
IGL03377:Atl2 APN 17 79865090 missense probably damaging 1.00
R0164:Atl2 UTSW 17 79853831 unclassified probably benign
R1203:Atl2 UTSW 17 79852905 missense probably damaging 0.99
R1489:Atl2 UTSW 17 79852706 missense probably benign 0.00
R1663:Atl2 UTSW 17 79864711 missense probably damaging 1.00
R1977:Atl2 UTSW 17 79852590 missense probably damaging 1.00
R2032:Atl2 UTSW 17 79895944 missense probably benign
R4063:Atl2 UTSW 17 79850159 makesense probably null
R5104:Atl2 UTSW 17 79852617 missense probably benign 0.01
R5201:Atl2 UTSW 17 79865151 missense probably benign
R5362:Atl2 UTSW 17 79861461 missense probably damaging 1.00
R5387:Atl2 UTSW 17 79852800 missense probably benign 0.03
R6128:Atl2 UTSW 17 79865041 critical splice donor site probably null
R6369:Atl2 UTSW 17 79854555 missense probably damaging 0.96
R6416:Atl2 UTSW 17 79850223 missense probably benign 0.00
R6883:Atl2 UTSW 17 79852553 missense probably damaging 1.00
X0052:Atl2 UTSW 17 79852617 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- CAGCAATCTGATCAATCATTGTTCC -3'
(R):5'- AAGCCGTACATTGCACCTTC -3'

Sequencing Primer
(F):5'- TCCCCAGAGTACTTAACATATGC -3'
(R):5'- CGTACATTGCACCTTCAGATTTGGAG -3'
Posted On2018-06-22