Incidental Mutation 'R6598:Zer1'
ID525013
Institutional Source Beutler Lab
Gene Symbol Zer1
Ensembl Gene ENSMUSG00000039686
Gene Namezyg-11 related, cell cycle regulator
SynonymsC230075L19Rik, Zyg11bl
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.216) question?
Stock #R6598 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location30097283-30124585 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 30113274 bp
ZygosityHeterozygous
Amino Acid Change Serine to Cysteine at position 44 (S44C)
Ref Sequence ENSEMBL: ENSMUSP00000109307 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000044751] [ENSMUST00000113677]
Predicted Effect probably damaging
Transcript: ENSMUST00000044751
AA Change: S44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000046441
Gene: ENSMUSG00000039686
AA Change: S44C

DomainStartEndE-ValueType
SCOP:d1jdha_ 405 774 3e-15 SMART
Blast:ARM 440 480 2e-18 BLAST
Blast:ARM 524 569 4e-24 BLAST
Blast:ARM 571 613 6e-22 BLAST
Blast:ARM 617 656 7e-8 BLAST
Blast:ARM 686 724 6e-18 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000113677
AA Change: S44C

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000109307
Gene: ENSMUSG00000039686
AA Change: S44C

DomainStartEndE-ValueType
SCOP:d1jdha_ 392 761 3e-15 SMART
Blast:ARM 427 467 2e-18 BLAST
Blast:ARM 511 556 4e-24 BLAST
Blast:ARM 558 600 2e-21 BLAST
Blast:ARM 604 643 7e-8 BLAST
Blast:ARM 673 711 6e-18 BLAST
Predicted Effect noncoding transcript
Transcript: ENSMUST00000133354
Predicted Effect noncoding transcript
Transcript: ENSMUST00000139128
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149818
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154231
Meta Mutation Damage Score 0.164 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.3%
  • 20x: 95.1%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a subunit of an E3 ubiquitin ligase complex that may be involved in meiosis. The encoded protein contains three leucine-rich repeat motifs. [provided by RefSeq, Nov 2012]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy4 A T 14: 55,770,045 S943T probably benign Het
Adgrv1 T G 13: 81,506,179 E2911A probably damaging Het
Ankrd28 A G 14: 31,708,939 F819S probably damaging Het
Cald1 G A 6: 34,746,640 probably null Het
Casc4 A T 2: 121,933,485 E247D probably damaging Het
Casc4 G A 2: 121,933,486 E383K probably damaging Het
Clca2 G T 3: 145,086,485 Y338* probably null Het
Cmya5 C T 13: 93,089,808 G2924D probably benign Het
Col6a4 A T 9: 106,000,412 L2122Q probably damaging Het
Dapk1 T C 13: 60,761,347 F1258S probably benign Het
Ddx39 T C 8: 83,722,927 V387A probably benign Het
Dscam A G 16: 96,819,784 C575R probably damaging Het
Dyrk4 C T 6: 126,876,326 V632M probably benign Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ermp1 A G 19: 29,632,502 S111P possibly damaging Het
Fbxo40 A T 16: 36,969,014 L578Q probably damaging Het
Frem1 A T 4: 83,013,828 F212Y probably damaging Het
Icos T G 1: 60,994,697 I162S possibly damaging Het
Kcnj8 G T 6: 142,570,233 N49K probably damaging Het
Ldhb A T 6: 142,490,600 M281K possibly damaging Het
Med17 T C 9: 15,271,700 K350E probably benign Het
Mpo A T 11: 87,799,972 N412I probably benign Het
Mrps24 A T 11: 5,704,713 D80E probably benign Het
Myo5c A G 9: 75,246,234 D134G probably damaging Het
Ndufs1 T C 1: 63,164,950 Q140R probably null Het
Nsd1 T C 13: 55,293,702 V1662A possibly damaging Het
Olfr1115 C T 2: 87,252,756 T273I probably damaging Het
Olfr470 G A 7: 107,845,263 L157F probably benign Het
Olfr794 C A 10: 129,571,369 T238N probably damaging Het
Polq G A 16: 37,061,631 A1386T probably benign Het
Ppil1 C A 17: 29,261,878 V24F probably benign Het
Prim1 G T 10: 128,020,180 V165L possibly damaging Het
Slc12a2 G A 18: 57,898,073 V317I probably benign Het
Tbpl1 A G 10: 22,707,849 V103A probably damaging Het
Tmprss11c C T 5: 86,289,233 E10K probably benign Het
Unc80 T G 1: 66,468,540 probably null Het
Uqcrc1 G T 9: 108,947,622 V30F possibly damaging Het
Vmn1r88 T C 7: 13,178,223 Y169H probably damaging Het
Zan A T 5: 137,406,364 probably benign Het
Zc3h13 A G 14: 75,332,183 D1490G probably damaging Het
Zfp106 T A 2: 120,535,060 K289* probably null Het
Zfp618 A G 4: 63,089,399 Y155C probably damaging Het
Zfp979 A G 4: 147,613,766 L162P probably damaging Het
Other mutations in Zer1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01098:Zer1 APN 2 30108220 critical splice donor site probably null
IGL01630:Zer1 APN 2 30101831 missense probably damaging 1.00
IGL02126:Zer1 APN 2 30104916 missense probably benign 0.10
IGL02338:Zer1 APN 2 30113393 missense probably damaging 1.00
IGL02817:Zer1 APN 2 30103394 missense probably damaging 0.99
PIT4402001:Zer1 UTSW 2 30101120 missense probably damaging 0.96
PIT4495001:Zer1 UTSW 2 30103543 missense probably benign 0.01
R0390:Zer1 UTSW 2 30108213 splice site probably benign
R0506:Zer1 UTSW 2 30101807 missense probably damaging 1.00
R0606:Zer1 UTSW 2 30104797 splice site probably benign
R0928:Zer1 UTSW 2 30101763 critical splice donor site probably null
R1167:Zer1 UTSW 2 30108246 missense probably benign 0.00
R1819:Zer1 UTSW 2 30110218 missense probably benign 0.18
R2040:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2041:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2042:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2092:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2168:Zer1 UTSW 2 30104875 missense probably damaging 1.00
R2243:Zer1 UTSW 2 30101127 missense probably damaging 0.99
R2254:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2255:Zer1 UTSW 2 30108274 missense probably damaging 1.00
R2311:Zer1 UTSW 2 30101822 missense probably damaging 0.99
R2993:Zer1 UTSW 2 30101897 missense probably damaging 1.00
R3010:Zer1 UTSW 2 30113285 missense probably benign 0.13
R3731:Zer1 UTSW 2 30110911 missense probably benign 0.44
R4038:Zer1 UTSW 2 30107523 missense probably damaging 1.00
R5241:Zer1 UTSW 2 30104970 missense probably damaging 1.00
R5433:Zer1 UTSW 2 30100986 intron probably benign
R5443:Zer1 UTSW 2 30110996 missense probably damaging 1.00
R5524:Zer1 UTSW 2 30104854 missense probably damaging 1.00
R5936:Zer1 UTSW 2 30107667 missense probably damaging 0.97
R5999:Zer1 UTSW 2 30104997 missense probably damaging 1.00
R6965:Zer1 UTSW 2 30101047 missense possibly damaging 0.87
R7030:Zer1 UTSW 2 30111021 missense probably benign 0.00
R7190:Zer1 UTSW 2 30103432 missense probably damaging 1.00
R7218:Zer1 UTSW 2 30105012 missense probably damaging 1.00
R7252:Zer1 UTSW 2 30101892 missense probably damaging 0.99
R7383:Zer1 UTSW 2 30111241 missense probably damaging 1.00
R7417:Zer1 UTSW 2 30102822 missense probably damaging 1.00
R7459:Zer1 UTSW 2 30113325 missense probably damaging 1.00
R7463:Zer1 UTSW 2 30113437 start gained probably benign
R7477:Zer1 UTSW 2 30107976 missense probably null 0.34
X0026:Zer1 UTSW 2 30104895 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TCTGTGCTGCATAATCCTACATG -3'
(R):5'- AATCCATAGTTGCCCTTGTGG -3'

Sequencing Primer
(F):5'- GTGCTGCATAATCCTACATGTATACC -3'
(R):5'- CTTGTGGGCCGCTGCTG -3'
Posted On2018-06-22