Mutagenetix > Incidental Mutation

Incidental Mutation 'R6631:Mrc1'

525096

Institutional Source

Beutler Lab

Gene Symbol

Mrc1

Ensembl Gene

ENSMUSG00000026712

Gene Name

mannose receptor, C type 1

Synonyms

CD206, MR

MMRRC Submission

044753-MU

Accession Numbers

Essential gene?

Probably non essential (E-score: 0.066) question?

Stock #

R6631 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

14234225-14336834 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

G to A at 14243296 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Valine to Isoleucine at position 141 (V141I)

Ref Sequence

ENSEMBL: ENSMUSP00000028045 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028045]

AlphaFold

Q61830

PDB Structure

CRYSTAL STRUCTURE OF THE CYSTEINE RICH DOMAIN OF MANNOSE RECEPTOR [X-RAY DIFFRACTION]
Crystal structure of the cysteine rich domain of mannose receptor complexed with Acetylgalactosamine-4-sulfate [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(X) [X-RAY DIFFRACTION]
CRYSTAL STRUCTURE OF THE CYSTEINE-RICH DOMAIN OF MANNOSE RECEPTOR COMPLEXED WITH 3-SO4-LEWIS(A) [X-RAY DIFFRACTION]

Predicted Effect

probably benign
Transcript: ENSMUST00000028045
AA Change: V141I

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)

SMART Domains

Protein: ENSMUSP00000028045
Gene: ENSMUSG00000026712
AA Change: V141I

Domain	Start	End	E-Value	Type
RICIN	22	142	8.09e-18	SMART
FN2	161	209	1.83e-27	SMART
CLECT	216	341	8.87e-26	SMART
CLECT	362	487	3.51e-38	SMART
CLECT	504	626	8.2e-30	SMART
CLECT	646	778	2.34e-34	SMART
CLECT	800	923	2.17e-29	SMART
low complexity region	935	941	N/A	INTRINSIC
CLECT	944	1079	3.35e-35	SMART
CLECT	1094	1212	4.11e-21	SMART
CLECT	1229	1355	3.63e-31	SMART
transmembrane domain	1388	1410	N/A	INTRINSIC

Meta Mutation Damage Score

0.0846

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.0%
20x: 93.9%

Validation Efficiency

96% (50/52)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The recognition of complex carbohydrate structures on glycoproteins is an important part of several biological processes, including cell-cell recognition, serum glycoprotein turnover, and neutralization of pathogens. The protein encoded by this gene is a type I membrane receptor that mediates the endocytosis of glycoproteins by macrophages. The protein has been shown to bind high-mannose structures on the surface of potentially pathogenic viruses, bacteria, and fungi so that they can be neutralized by phagocytic engulfment.[provided by RefSeq, Sep 2015]
PHENOTYPE: Male homozygotes for one targeted null mutation die in utero. Heterozygous females clear lutropin from the circulation more slowly and have smaller litters due to reduced implantation. Another targeted knockout is viable and homozygotes are less susceptible to parasitic infection. [provided by MGI curators]

Allele List at MGI

All alleles(2) : Targeted(2)

Other mutations in this stock

Total: 52 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
4931406C07Rik	A	T	9: 15,203,326 (GRCm39)	N159K	probably damaging	Het
Arhgef10l	T	C	4: 140,245,058 (GRCm39)		probably benign	Het
Atosa	A	G	9: 74,861,107 (GRCm39)	D4G	possibly damaging	Het
Avil	A	G	10: 126,843,618 (GRCm39)	S153G	possibly damaging	Het
C2cd3	G	A	7: 100,067,747 (GRCm39)	D877N	probably damaging	Het
Clca3a2	G	A	3: 144,519,405 (GRCm39)	A257V	probably benign	Het
Cramp1	T	A	17: 25,202,931 (GRCm39)	H366L	probably benign	Het
Cyp2c37	C	T	19: 39,998,287 (GRCm39)	S393L	probably damaging	Het
Defb8	T	A	8: 19,495,950 (GRCm39)	I37L	probably benign	Het
Dennd4b	C	A	3: 90,185,039 (GRCm39)		probably null	Het
Eps8l2	G	A	7: 140,936,115 (GRCm39)	R223H	probably damaging	Het
Erbin	A	G	13: 103,961,400 (GRCm39)	L1302P	probably benign	Het
Exoc3l	A	G	8: 106,021,993 (GRCm39)	W37R	probably damaging	Het
Fap	T	C	2: 62,333,725 (GRCm39)	N668S	probably damaging	Het
Gas7	A	G	11: 67,565,107 (GRCm39)	N250S	probably damaging	Het
H2bc12	T	A	13: 22,220,391 (GRCm39)	V112E	probably damaging	Het
Hivep1	C	A	13: 42,309,956 (GRCm39)	P732Q	probably damaging	Het
Irx4	G	T	13: 73,416,545 (GRCm39)	A314S	probably benign	Het
Itgb8	A	T	12: 119,144,712 (GRCm39)	L332*	probably null	Het
Kctd19	A	G	8: 106,111,960 (GRCm39)		probably null	Het
Kif14	G	A	1: 136,443,697 (GRCm39)	S1290N	probably benign	Het
Klk1b3	C	T	7: 43,850,888 (GRCm39)	T140I	probably benign	Het
Lama1	A	G	17: 68,081,477 (GRCm39)	N1305D	probably benign	Het
Lrp1	A	T	10: 127,410,201 (GRCm39)	V1515E	probably damaging	Het
Man2b1	A	G	8: 85,813,440 (GRCm39)		probably null	Het
Mocos	A	G	18: 24,832,988 (GRCm39)	T818A	probably benign	Het
Mpc2	G	T	1: 165,307,081 (GRCm39)	W94L	probably benign	Het
Nalcn	T	C	14: 123,697,663 (GRCm39)	T538A	probably benign	Het
Ndufs3	G	A	2: 90,732,744 (GRCm39)	T114M	probably damaging	Het
Noct	T	C	3: 51,157,621 (GRCm39)	C320R	probably damaging	Het
Or5b117	T	A	19: 13,431,185 (GRCm39)	Q232L	probably benign	Het
Pcdha11	G	T	18: 37,138,844 (GRCm39)	A158S	probably damaging	Het
Pcdhga8	T	A	18: 37,860,109 (GRCm39)	D388E	probably benign	Het
Peg3	T	C	7: 6,712,069 (GRCm39)	E1051G	possibly damaging	Het
Phlda2	T	A	7: 143,055,918 (GRCm39)	I104F	probably damaging	Het
Polr2a	A	G	11: 69,626,339 (GRCm39)	S1604P	possibly damaging	Het
Pomt2	C	T	12: 87,186,417 (GRCm39)		probably null	Het
Ppp6r2	G	A	15: 89,137,458 (GRCm39)		probably null	Het
Prdm2	T	G	4: 142,861,454 (GRCm39)	Q612P	probably benign	Het
Prr5	C	A	15: 84,586,978 (GRCm39)	R243S	probably damaging	Het
Ptgdr2	T	C	19: 10,918,233 (GRCm39)	I250T	probably benign	Het
Rad54l2	A	T	9: 106,590,739 (GRCm39)	C462*	probably null	Het
Sec16a	T	A	2: 26,329,969 (GRCm39)	E682V	probably damaging	Het
Serpina3i	A	G	12: 104,232,725 (GRCm39)	D210G	probably damaging	Het
Slain2	T	A	5: 73,114,748 (GRCm39)	D326E	probably benign	Het
Sned1	A	G	1: 93,209,374 (GRCm39)	E829G	probably damaging	Het
Steap4	G	A	5: 8,026,995 (GRCm39)	W319*	probably null	Het
Taar8c	A	G	10: 23,977,701 (GRCm39)	V37A	probably benign	Het
Tdrd12	T	A	7: 35,184,654 (GRCm39)	Y753F	probably damaging	Het
Tnxb	A	G	17: 34,937,222 (GRCm39)	S3770G	probably damaging	Het
Trrap	A	G	5: 144,708,460 (GRCm39)	N48S	possibly damaging	Het
Zfp558	C	A	9: 18,368,219 (GRCm39)	G190*	probably null	Het

Other mutations in Mrc1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL01013:Mrc1	APN	2	14,333,236 (GRCm39)	missense	probably damaging	1.00
IGL01326:Mrc1	APN	2	14,271,335 (GRCm39)	missense	probably damaging	1.00
IGL01340:Mrc1	APN	2	14,314,895 (GRCm39)	critical splice donor site	probably null
IGL01758:Mrc1	APN	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
IGL01799:Mrc1	APN	2	14,243,187 (GRCm39)	missense	probably damaging	1.00
IGL02280:Mrc1	APN	2	14,249,024 (GRCm39)	missense	probably benign	0.19
IGL02435:Mrc1	APN	2	14,253,671 (GRCm39)	nonsense	probably null
IGL03073:Mrc1	APN	2	14,310,153 (GRCm39)	missense	probably damaging	1.00
IGL03110:Mrc1	APN	2	14,298,289 (GRCm39)	nonsense	probably null
IGL03155:Mrc1	APN	2	14,335,912 (GRCm39)	missense	probably benign	0.00
IGL03289:Mrc1	APN	2	14,313,634 (GRCm39)	critical splice donor site	probably null
amlodipine	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
losartan	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
Shug	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
sussigkeit	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0011:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0066:Mrc1	UTSW	2	14,266,011 (GRCm39)	missense	probably benign	0.42
R0110:Mrc1	UTSW	2	14,243,353 (GRCm39)	splice site	probably benign
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0234:Mrc1	UTSW	2	14,284,705 (GRCm39)	missense	possibly damaging	0.65
R0381:Mrc1	UTSW	2	14,312,720 (GRCm39)	missense	probably benign	0.05
R0505:Mrc1	UTSW	2	14,314,843 (GRCm39)	missense	probably damaging	1.00
R0539:Mrc1	UTSW	2	14,274,937 (GRCm39)	splice site	probably benign
R0613:Mrc1	UTSW	2	14,299,630 (GRCm39)	missense	probably damaging	0.96
R0626:Mrc1	UTSW	2	14,333,382 (GRCm39)	nonsense	probably null
R1122:Mrc1	UTSW	2	14,266,147 (GRCm39)	critical splice donor site	probably null
R1281:Mrc1	UTSW	2	14,298,321 (GRCm39)	missense	probably damaging	1.00
R1399:Mrc1	UTSW	2	14,284,736 (GRCm39)	missense	probably damaging	1.00
R1428:Mrc1	UTSW	2	14,320,074 (GRCm39)	missense	probably benign	0.11
R1571:Mrc1	UTSW	2	14,313,544 (GRCm39)	missense	probably damaging	0.97
R1596:Mrc1	UTSW	2	14,253,701 (GRCm39)	missense	possibly damaging	0.91
R1730:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1733:Mrc1	UTSW	2	14,261,910 (GRCm39)	missense	probably damaging	1.00
R1783:Mrc1	UTSW	2	14,332,655 (GRCm39)	missense	probably benign	0.01
R1860:Mrc1	UTSW	2	14,333,390 (GRCm39)	missense	probably benign	0.30
R1872:Mrc1	UTSW	2	14,330,192 (GRCm39)	splice site	probably null
R1889:Mrc1	UTSW	2	14,313,488 (GRCm39)	critical splice acceptor site	probably null
R1938:Mrc1	UTSW	2	14,324,052 (GRCm39)	missense	possibly damaging	0.89
R1971:Mrc1	UTSW	2	14,249,103 (GRCm39)	critical splice donor site	probably null
R2031:Mrc1	UTSW	2	14,326,584 (GRCm39)	missense	probably damaging	1.00
R2136:Mrc1	UTSW	2	14,275,000 (GRCm39)	missense	probably damaging	1.00
R2152:Mrc1	UTSW	2	14,332,675 (GRCm39)	missense	probably damaging	1.00
R2168:Mrc1	UTSW	2	14,249,015 (GRCm39)	missense	possibly damaging	0.90
R2273:Mrc1	UTSW	2	14,330,183 (GRCm39)	missense	probably damaging	1.00
R2901:Mrc1	UTSW	2	14,333,354 (GRCm39)	missense	possibly damaging	0.94
R3767:Mrc1	UTSW	2	14,323,981 (GRCm39)	missense	probably damaging	1.00
R3795:Mrc1	UTSW	2	14,293,793 (GRCm39)	splice site	probably benign
R4028:Mrc1	UTSW	2	14,243,059 (GRCm39)	missense	probably damaging	1.00
R4668:Mrc1	UTSW	2	14,298,297 (GRCm39)	missense	probably damaging	1.00
R4828:Mrc1	UTSW	2	14,275,017 (GRCm39)	missense	probably damaging	1.00
R4897:Mrc1	UTSW	2	14,323,952 (GRCm39)	missense	probably benign	0.01
R4950:Mrc1	UTSW	2	14,276,091 (GRCm39)	missense	probably damaging	1.00
R5000:Mrc1	UTSW	2	14,249,000 (GRCm39)	missense	probably damaging	1.00
R5068:Mrc1	UTSW	2	14,311,327 (GRCm39)	missense	probably benign	0.00
R5279:Mrc1	UTSW	2	14,314,869 (GRCm39)	missense	probably damaging	0.99
R5366:Mrc1	UTSW	2	14,326,725 (GRCm39)	missense	probably benign	0.03
R5436:Mrc1	UTSW	2	14,271,326 (GRCm39)	missense	probably damaging	1.00
R5552:Mrc1	UTSW	2	14,284,768 (GRCm39)	missense	probably benign	0.05
R5631:Mrc1	UTSW	2	14,333,383 (GRCm39)	nonsense	probably null
R5831:Mrc1	UTSW	2	14,313,523 (GRCm39)	missense	probably damaging	0.99
R5978:Mrc1	UTSW	2	14,320,204 (GRCm39)	missense	probably damaging	0.97
R5993:Mrc1	UTSW	2	14,310,138 (GRCm39)	missense	probably damaging	1.00
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6030:Mrc1	UTSW	2	14,321,712 (GRCm39)	missense	probably benign	0.04
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6038:Mrc1	UTSW	2	14,261,882 (GRCm39)	missense	probably damaging	1.00
R6228:Mrc1	UTSW	2	14,276,115 (GRCm39)	missense	probably benign	0.08
R6344:Mrc1	UTSW	2	14,248,985 (GRCm39)	missense	probably damaging	1.00
R6457:Mrc1	UTSW	2	14,275,016 (GRCm39)	missense	probably damaging	1.00
R6520:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R6619:Mrc1	UTSW	2	14,299,597 (GRCm39)	splice site	probably null
R6737:Mrc1	UTSW	2	14,276,088 (GRCm39)	missense	possibly damaging	0.95
R6782:Mrc1	UTSW	2	14,266,148 (GRCm39)	critical splice donor site	probably null
R6887:Mrc1	UTSW	2	14,330,048 (GRCm39)	missense	possibly damaging	0.94
R7108:Mrc1	UTSW	2	14,308,957 (GRCm39)	nonsense	probably null
R7120:Mrc1	UTSW	2	14,313,508 (GRCm39)	missense	probably damaging	0.97
R7460:Mrc1	UTSW	2	14,253,680 (GRCm39)	missense	probably damaging	1.00
R7567:Mrc1	UTSW	2	14,330,104 (GRCm39)	missense	probably damaging	1.00
R7606:Mrc1	UTSW	2	14,242,955 (GRCm39)	missense	probably damaging	1.00
R7725:Mrc1	UTSW	2	14,284,788 (GRCm39)	missense	probably benign	0.03
R7826:Mrc1	UTSW	2	14,299,668 (GRCm39)	missense	probably damaging	1.00
R8082:Mrc1	UTSW	2	14,253,771 (GRCm39)	missense	probably benign
R8279:Mrc1	UTSW	2	14,271,168 (GRCm39)	missense	possibly damaging	0.89
R8888:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8895:Mrc1	UTSW	2	14,312,760 (GRCm39)	missense	probably damaging	1.00
R8952:Mrc1	UTSW	2	14,253,735 (GRCm39)	missense	probably damaging	0.98
R9315:Mrc1	UTSW	2	14,248,969 (GRCm39)	nonsense	probably null
R9366:Mrc1	UTSW	2	14,321,709 (GRCm39)	missense	probably damaging	0.99
R9373:Mrc1	UTSW	2	14,274,999 (GRCm39)	missense	probably damaging	0.99
R9418:Mrc1	UTSW	2	14,234,358 (GRCm39)	missense	probably benign	0.12
R9420:Mrc1	UTSW	2	14,312,790 (GRCm39)	missense	possibly damaging	0.53
R9489:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9564:Mrc1	UTSW	2	14,266,117 (GRCm39)	missense	probably benign	0.00
R9572:Mrc1	UTSW	2	14,234,334 (GRCm39)	missense	probably benign
R9605:Mrc1	UTSW	2	14,324,110 (GRCm39)	missense	probably benign	0.06
R9606:Mrc1	UTSW	2	14,313,517 (GRCm39)	missense	probably benign	0.01
R9781:Mrc1	UTSW	2	14,310,175 (GRCm39)	missense	possibly damaging	0.90
R9781:Mrc1	UTSW	2	14,249,100 (GRCm39)	missense	probably benign
Z1177:Mrc1	UTSW	2	14,293,927 (GRCm39)	missense	probably damaging	1.00
Z1177:Mrc1	UTSW	2	14,248,949 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- AAATTCCGCTGGGTGTCAG -3'
(R):5'- GGGGACATTTTCTCACACATTTG -3'

Sequencing Primer
(F):5'- AAAACTGACTGGGCTTCCGTC -3'
(R):5'- GTTATCACGCTTGTCTAGAACACGG -3'

Posted On

2018-06-22