Incidental Mutation 'R6599:Prokr2'
List |< first << previous [record 27 of 39] next >> last >|
ID525101
Institutional Source Beutler Lab
Gene Symbol Prokr2
Ensembl Gene ENSMUSG00000050558
Gene Nameprokineticin receptor 2
SynonymsGpcr73l1, B830005M06Rik, PKR2, EG-VEGRF2, Gpr73l1
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.245) question?
Stock #R6599 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location132337733-132385447 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) C to T at 132373549 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 331 (V331M)
Ref Sequence ENSEMBL: ENSMUSP00000105784 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049997] [ENSMUST00000110156] [ENSMUST00000110157] [ENSMUST00000142766]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049997
AA Change: V331M

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000056659
Gene: ENSMUSG00000050558
AA Change: V331M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 61 349 3.3e-7 PFAM
Pfam:7tm_1 67 330 8.2e-48 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000110156
AA Change: V331M

PolyPhen 2 Score 0.918 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000105784
Gene: ENSMUSG00000050558
AA Change: V331M

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 61 349 3.3e-7 PFAM
Pfam:7tm_1 67 330 1.7e-48 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000110157
SMART Domains Protein: ENSMUSP00000105785
Gene: ENSMUSG00000050558

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 61 153 5.2e-7 PFAM
Pfam:7tm_1 67 155 1.7e-19 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000142766
AA Change: V170M

PolyPhen 2 Score 0.802 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000124526
Gene: ENSMUSG00000050558
AA Change: V170M

DomainStartEndE-ValueType
Pfam:7tm_1 1 169 4.9e-19 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Prokineticins are secreted proteins that can promote angiogenesis and induce strong gastrointestinal smooth muscle contraction. The protein encoded by this gene is an integral membrane protein and G protein-coupled receptor for prokineticins. The encoded protein is similar in sequence to GPR73, another G protein-coupled receptor for prokineticins. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for a null allele show 50% neonatal lethality, olfactory bulb malformation, and reproductive system atrophy related to a lack of hypothalamic gonadotropin-releasing hormone synthesizing neurons. Homozygotes for another null allele show impaired circadian behavior and thermoregulation. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Adcyap1r1 G A 6: 55,479,994 V237M probably damaging Het
Akr1c6 T G 13: 4,449,319 probably null Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dhx40 T A 11: 86,804,349 I112L possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Gm8267 G T 14: 44,717,910 T218K possibly damaging Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Hist1h1d T C 13: 23,555,277 probably null Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Mthfs G A 9: 89,239,908 G149D probably damaging Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Nqo2 T C 13: 33,979,556 F22S probably damaging Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Olfr869 T C 9: 20,137,943 S276P probably damaging Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Tcaim C T 9: 122,834,779 Q445* probably null Het
Trpc7 T C 13: 56,810,380 probably null Het
Ubxn7 A G 16: 32,384,925 E465G probably damaging Het
Unk G A 11: 116,047,802 R77Q probably damaging Het
Vmn1r226 A T 17: 20,688,289 N261I probably benign Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Yipf2 T C 9: 21,589,848 K85E probably damaging Het
Zfp979 A T 4: 147,613,626 C209S probably benign Het
Other mutations in Prokr2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00592:Prokr2 APN 2 132381504 missense probably benign 0.28
IGL01948:Prokr2 APN 2 132373683 missense probably damaging 0.97
IGL02930:Prokr2 APN 2 132373474 missense probably benign 0.00
R0092:Prokr2 UTSW 2 132373597 missense probably damaging 1.00
R0717:Prokr2 UTSW 2 132381334 missense probably damaging 1.00
R1547:Prokr2 UTSW 2 132373602 missense probably damaging 1.00
R1573:Prokr2 UTSW 2 132373764 missense probably damaging 0.99
R2302:Prokr2 UTSW 2 132381184 missense probably damaging 1.00
R2336:Prokr2 UTSW 2 132381439 missense probably damaging 0.99
R2483:Prokr2 UTSW 2 132381175 missense probably damaging 1.00
R4049:Prokr2 UTSW 2 132381494 missense probably benign 0.16
R4518:Prokr2 UTSW 2 132374092 critical splice acceptor site probably null
R4947:Prokr2 UTSW 2 132373653 missense probably damaging 1.00
R5961:Prokr2 UTSW 2 132373675 missense possibly damaging 0.95
R5997:Prokr2 UTSW 2 132381442 missense probably damaging 0.99
R6333:Prokr2 UTSW 2 132373978 missense probably damaging 0.98
R6543:Prokr2 UTSW 2 132373899 missense probably benign 0.13
R6623:Prokr2 UTSW 2 132373574 missense probably damaging 1.00
R7092:Prokr2 UTSW 2 132381316 missense possibly damaging 0.88
R7252:Prokr2 UTSW 2 132381440 missense probably benign 0.03
Predicted Primers PCR Primer
(F):5'- GGCAACACCTGAAGGCTACTTTAG -3'
(R):5'- CTTCCAGACGGAGCAAATCC -3'

Sequencing Primer
(F):5'- CCTGAAGGCTACTTTAGTCTGATAC -3'
(R):5'- AGTGCTACTGCTCATGGGCATC -3'
Posted On2018-06-22