Incidental Mutation 'R6599:Adcyap1r1'
List |< first << previous [record 3 of 39] next >> last >|
ID525112
Institutional Source Beutler Lab
Gene Symbol Adcyap1r1
Ensembl Gene ENSMUSG00000029778
Gene Nameadenylate cyclase activating polypeptide 1 receptor 1
SynonymsPAC1R, PAC1, PACAP1-R, 2900024I10Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.270) question?
Stock #R6599 (G1)
Quality Score225.009
Status Validated
Chromosome6
Chromosomal Location55451978-55501451 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 55479994 bp
ZygosityHeterozygous
Amino Acid Change Valine to Methionine at position 237 (V237M)
Ref Sequence ENSEMBL: ENSMUSP00000126994 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000070736] [ENSMUST00000070756] [ENSMUST00000165786] [ENSMUST00000165857] [ENSMUST00000166962] [ENSMUST00000167234] [ENSMUST00000172084]
Predicted Effect probably damaging
Transcript: ENSMUST00000070736
AA Change: V237M

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000063784
Gene: ENSMUSG00000029778
AA Change: V237M

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 424 3.6e-92 PFAM
low complexity region 474 489 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000070756
AA Change: V237M

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000066902
Gene: ENSMUSG00000029778
AA Change: V237M

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 396 2.6e-93 PFAM
low complexity region 446 461 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165786
AA Change: V237M

PolyPhen 2 Score 0.989 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000130923
Gene: ENSMUSG00000029778
AA Change: V237M

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 423 2.6e-92 PFAM
low complexity region 473 488 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000165857
AA Change: V237M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000129614
Gene: ENSMUSG00000029778
AA Change: V237M

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 424 1.4e-94 PFAM
low complexity region 474 489 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000166962
SMART Domains Protein: ENSMUSP00000130742
Gene: ENSMUSG00000029778

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
Pfam:HRM 51 131 2.3e-18 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000167234
AA Change: V237M

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000126994
Gene: ENSMUSG00000029778
AA Change: V237M

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 143 7.2e-29 SMART
Pfam:7tm_2 150 452 1.4e-91 PFAM
low complexity region 502 517 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000172084
AA Change: V216M

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000127319
Gene: ENSMUSG00000029778
AA Change: V216M

DomainStartEndE-ValueType
low complexity region 5 15 N/A INTRINSIC
HormR 50 122 2.15e-27 SMART
Pfam:7tm_2 129 375 9e-94 PFAM
low complexity region 425 440 N/A INTRINSIC
Meta Mutation Damage Score 0.0416 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes type I adenylate cyclase activating polypeptide receptor, which is a membrane-associated protein and shares significant homology with members of the glucagon/secretin receptor family. This receptor mediates diverse biological actions of adenylate cyclase activating polypeptide 1 and is positively coupled to adenylate cyclase. Multiple alternatively spliced transcript variants encoding distinct isoforms have been identified. [provided by RefSeq, Dec 2010]
PHENOTYPE: Homozygotes for targeted mutations affect contextual fear conditioning, elevated locomotor activity, anxiety-like behavior, susceptibility to endotoxic shock, circadian responses to a photic stimulus, and glucose tolerance. Some alleles affect female fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Akr1c6 T G 13: 4,449,319 probably null Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dhx40 T A 11: 86,804,349 I112L possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Gm8267 G T 14: 44,717,910 T218K possibly damaging Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Hist1h1d T C 13: 23,555,277 probably null Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Mthfs G A 9: 89,239,908 G149D probably damaging Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Nqo2 T C 13: 33,979,556 F22S probably damaging Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Olfr869 T C 9: 20,137,943 S276P probably damaging Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Prokr2 C T 2: 132,373,549 V331M possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Tcaim C T 9: 122,834,779 Q445* probably null Het
Trpc7 T C 13: 56,810,380 probably null Het
Ubxn7 A G 16: 32,384,925 E465G probably damaging Het
Unk G A 11: 116,047,802 R77Q probably damaging Het
Vmn1r226 A T 17: 20,688,289 N261I probably benign Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Yipf2 T C 9: 21,589,848 K85E probably damaging Het
Zfp979 A T 4: 147,613,626 C209S probably benign Het
Other mutations in Adcyap1r1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00497:Adcyap1r1 APN 6 55472279 missense probably damaging 1.00
IGL00837:Adcyap1r1 APN 6 55461620 splice site probably benign
IGL02686:Adcyap1r1 APN 6 55481125 missense probably benign 0.37
IGL03229:Adcyap1r1 APN 6 55478123 missense probably damaging 1.00
PIT4458001:Adcyap1r1 UTSW 6 55478082 missense probably benign 0.00
R0360:Adcyap1r1 UTSW 6 55475523 intron probably benign
R0517:Adcyap1r1 UTSW 6 55491297 missense probably damaging 0.99
R1169:Adcyap1r1 UTSW 6 55494116 missense probably damaging 1.00
R1897:Adcyap1r1 UTSW 6 55479194 missense probably damaging 1.00
R2113:Adcyap1r1 UTSW 6 55481115 missense probably damaging 0.99
R4462:Adcyap1r1 UTSW 6 55480099 missense possibly damaging 0.90
R4871:Adcyap1r1 UTSW 6 55480093 missense probably null 0.34
R5146:Adcyap1r1 UTSW 6 55484972 missense probably benign 0.00
R5341:Adcyap1r1 UTSW 6 55478069 missense probably benign 0.00
R6426:Adcyap1r1 UTSW 6 55494187 missense probably damaging 1.00
R6928:Adcyap1r1 UTSW 6 55479272 missense possibly damaging 0.92
R7059:Adcyap1r1 UTSW 6 55491310 missense probably damaging 0.98
Predicted Primers PCR Primer
(F):5'- GGCTTTGAGATACCTGAAGCTG -3'
(R):5'- AGAAGCTCACAGCCTCGTATG -3'

Sequencing Primer
(F):5'- ATACCTGAAGCTGGGTATGCC -3'
(R):5'- CGTATGGGCTCTATTATCCAATGC -3'
Posted On2018-06-22