Incidental Mutation 'R6599:Olfr869'
List |< first << previous [record 25 of 39] next >> last >|
ID525123
Institutional Source Beutler Lab
Gene Symbol Olfr869
Ensembl Gene ENSMUSG00000058491
Gene Nameolfactory receptor 869
SynonymsMOR145-6, GA_x6K02T2PVTD-13878275-13879204
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.062) question?
Stock #R6599 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location20129009-20138763 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 20137943 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 276 (S276P)
Ref Sequence ENSEMBL: ENSMUSP00000154723 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000075717] [ENSMUST00000213024]
Predicted Effect probably damaging
Transcript: ENSMUST00000075717
AA Change: S276P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000075135
Gene: ENSMUSG00000049028
AA Change: S276P

DomainStartEndE-ValueType
Pfam:7tm_4 45 321 6.2e-43 PFAM
Pfam:7TM_GPCR_Srsx 49 309 3e-8 PFAM
Pfam:7tm_1 55 304 1.5e-20 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213024
AA Change: S276P

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Adcyap1r1 G A 6: 55,479,994 V237M probably damaging Het
Akr1c6 T G 13: 4,449,319 probably null Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dhx40 T A 11: 86,804,349 I112L possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Gm8267 G T 14: 44,717,910 T218K possibly damaging Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Hist1h1d T C 13: 23,555,277 probably null Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Mthfs G A 9: 89,239,908 G149D probably damaging Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Nqo2 T C 13: 33,979,556 F22S probably damaging Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Prokr2 C T 2: 132,373,549 V331M possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Tcaim C T 9: 122,834,779 Q445* probably null Het
Trpc7 T C 13: 56,810,380 probably null Het
Ubxn7 A G 16: 32,384,925 E465G probably damaging Het
Unk G A 11: 116,047,802 R77Q probably damaging Het
Vmn1r226 A T 17: 20,688,289 N261I probably benign Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Yipf2 T C 9: 21,589,848 K85E probably damaging Het
Zfp979 A T 4: 147,613,626 C209S probably benign Het
Other mutations in Olfr869
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00966:Olfr869 APN 9 20137235 missense probably benign
IGL01550:Olfr869 APN 9 20137454 missense probably damaging 0.97
IGL02247:Olfr869 APN 9 20137220 missense probably benign 0.01
IGL02448:Olfr869 APN 9 20137641 nonsense probably null
IGL03076:Olfr869 APN 9 20137727 missense probably benign 0.25
R0045:Olfr869 UTSW 9 20137191 missense probably benign 0.25
R0962:Olfr869 UTSW 9 20137538 missense probably damaging 1.00
R4588:Olfr869 UTSW 9 20138087 makesense probably null
R4931:Olfr869 UTSW 9 20137562 missense probably benign 0.19
R5030:Olfr869 UTSW 9 20138067 missense probably benign 0.01
R5759:Olfr869 UTSW 9 20137932 missense probably benign 0.12
R5780:Olfr869 UTSW 9 20137497 missense probably damaging 0.98
R6440:Olfr869 UTSW 9 20137194 missense probably damaging 1.00
R6710:Olfr869 UTSW 9 20138082 missense probably benign 0.01
R6953:Olfr869 UTSW 9 20138003 missense probably benign 0.00
R7288:Olfr869 UTSW 9 20137441 nonsense probably null
Predicted Primers PCR Primer
(F):5'- CACTTCAGTGGCATGGAAATCTC -3'
(R):5'- TGTAGTAGAATGAAAGCCACAACAC -3'

Sequencing Primer
(F):5'- CTGTTCTGAAATGTTCACCAAAAGC -3'
(R):5'- CTCAAACTTCAAAAATGATGGAAGGC -3'
Posted On2018-06-22