Incidental Mutation 'R6599:Yipf2'
List |< first << previous [record 38 of 39] next >> last >|
ID525125
Institutional Source Beutler Lab
Gene Symbol Yipf2
Ensembl Gene ENSMUSG00000032182
Gene NameYip1 domain family, member 2
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.152) question?
Stock #R6599 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location21588682-21592828 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 21589848 bp
ZygosityHeterozygous
Amino Acid Change Lysine to Glutamic Acid at position 85 (K85E)
Ref Sequence ENSEMBL: ENSMUSP00000149626 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034700] [ENSMUST00000034703] [ENSMUST00000062125] [ENSMUST00000078572] [ENSMUST00000115394] [ENSMUST00000115395] [ENSMUST00000130032] [ENSMUST00000180365] [ENSMUST00000213809]
Predicted Effect possibly damaging
Transcript: ENSMUST00000034700
AA Change: K275E

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000034700
Gene: ENSMUSG00000032182
AA Change: K275E

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000034703
SMART Domains Protein: ENSMUSP00000034703
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.1e-71 PFAM
Pfam:PRMT5 144 447 2.3e-16 PFAM
Pfam:MTS 166 308 2.7e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 173 287 2.2e-12 PFAM
Pfam:Methyltransf_31 183 325 7.4e-11 PFAM
Pfam:Methyltransf_18 185 290 5.1e-12 PFAM
Pfam:Methyltransf_26 186 287 5.3e-10 PFAM
Pfam:Methyltransf_11 190 287 8.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 562 576 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000062125
SMART Domains Protein: ENSMUSP00000058283
Gene: ENSMUSG00000048429

DomainStartEndE-ValueType
Pfam:DUF2366 26 192 2.1e-63 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000078572
AA Change: K275E

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000077649
Gene: ENSMUSG00000032182
AA Change: K275E

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000115394
SMART Domains Protein: ENSMUSP00000111052
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 29 140 4.7e-63 PFAM
Pfam:PRMT5 145 447 4.1e-16 PFAM
Pfam:Methyltransf_9 168 318 1.4e-9 PFAM
Pfam:MTS 170 299 2.5e-9 PFAM
Pfam:PrmA 175 287 3.7e-12 PFAM
Pfam:Methyltransf_31 183 326 1.9e-10 PFAM
Pfam:Methyltransf_18 185 290 4e-9 PFAM
Pfam:Methyltransf_11 190 287 6.5e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 606 619 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000115395
SMART Domains Protein: ENSMUSP00000111053
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2e-71 PFAM
Pfam:PRMT5 144 447 2.1e-16 PFAM
Pfam:MTS 166 308 2.6e-10 PFAM
Pfam:Methyltransf_9 168 318 1.1e-9 PFAM
Pfam:PrmA 172 287 2.1e-12 PFAM
Pfam:Methyltransf_31 183 326 6.9e-11 PFAM
Pfam:Methyltransf_18 185 290 4.8e-12 PFAM
Pfam:Methyltransf_26 186 287 5e-10 PFAM
Pfam:Methyltransf_11 190 287 8.1e-7 PFAM
low complexity region 477 494 N/A INTRINSIC
low complexity region 540 553 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000130032
SMART Domains Protein: ENSMUSP00000117243
Gene: ENSMUSG00000032185

DomainStartEndE-ValueType
Pfam:CARM1 27 140 2.8e-73 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000130100
Predicted Effect noncoding transcript
Transcript: ENSMUST00000132011
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154049
Predicted Effect possibly damaging
Transcript: ENSMUST00000180365
AA Change: K275E

PolyPhen 2 Score 0.956 (Sensitivity: 0.79; Specificity: 0.95)
SMART Domains Protein: ENSMUSP00000136463
Gene: ENSMUSG00000032182
AA Change: K275E

DomainStartEndE-ValueType
Pfam:Yip1 84 272 1.5e-21 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000213809
AA Change: K85E

PolyPhen 2 Score 0.983 (Sensitivity: 0.75; Specificity: 0.96)
Predicted Effect probably benign
Transcript: ENSMUST00000216160
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Adcyap1r1 G A 6: 55,479,994 V237M probably damaging Het
Akr1c6 T G 13: 4,449,319 probably null Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dhx40 T A 11: 86,804,349 I112L possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Gm8267 G T 14: 44,717,910 T218K possibly damaging Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Hist1h1d T C 13: 23,555,277 probably null Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Mthfs G A 9: 89,239,908 G149D probably damaging Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Nqo2 T C 13: 33,979,556 F22S probably damaging Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Olfr869 T C 9: 20,137,943 S276P probably damaging Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Prokr2 C T 2: 132,373,549 V331M possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Tcaim C T 9: 122,834,779 Q445* probably null Het
Trpc7 T C 13: 56,810,380 probably null Het
Ubxn7 A G 16: 32,384,925 E465G probably damaging Het
Unk G A 11: 116,047,802 R77Q probably damaging Het
Vmn1r226 A T 17: 20,688,289 N261I probably benign Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Zfp979 A T 4: 147,613,626 C209S probably benign Het
Other mutations in Yipf2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Yipf2 APN 9 21592524 splice site probably null
IGL02221:Yipf2 APN 9 21591468 missense possibly damaging 0.60
IGL02559:Yipf2 APN 9 21592186 missense probably damaging 0.96
IGL03055:Yipf2 UTSW 9 21589723 missense probably benign 0.00
R0089:Yipf2 UTSW 9 21591966 missense possibly damaging 0.89
R0113:Yipf2 UTSW 9 21590116 missense probably damaging 0.98
R0725:Yipf2 UTSW 9 21592223 splice site probably null
R2294:Yipf2 UTSW 9 21589881 missense probably damaging 1.00
R3154:Yipf2 UTSW 9 21589901 missense probably benign 0.01
R3428:Yipf2 UTSW 9 21589645 intron probably benign
R4956:Yipf2 UTSW 9 21591908 missense probably damaging 1.00
R5353:Yipf2 UTSW 9 21591932 missense possibly damaging 0.66
R5490:Yipf2 UTSW 9 21592191 missense probably benign 0.10
R7050:Yipf2 UTSW 9 21592178 missense probably benign 0.00
R7206:Yipf2 UTSW 9 21590361 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CTCACCTATGAGCCTTCCTAGG -3'
(R):5'- TAGGTCCTGTGGCTTATCCCAG -3'

Sequencing Primer
(F):5'- CTGGATTGAACTGGGCAGC -3'
(R):5'- GCTTATCCCAGTGCAGTGGATAC -3'
Posted On2018-06-22