Incidental Mutation 'R6599:Mthfs'
List |< first << previous [record 21 of 39] next >> last >|
ID525129
Institutional Source Beutler Lab
Gene Symbol Mthfs
Ensembl Gene ENSMUSG00000066442
Gene Name5, 10-methenyltetrahydrofolate synthetase
Synonyms2310020H23Rik, 1110034I12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6599 (G1)
Quality Score124.008
Status Not validated
Chromosome9
Chromosomal Location89210676-89377713 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 89239908 bp
ZygosityHeterozygous
Amino Acid Change Glycine to Aspartic acid at position 149 (G149D)
Ref Sequence ENSEMBL: ENSMUSP00000082354 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000085256]
Predicted Effect probably damaging
Transcript: ENSMUST00000085256
AA Change: G149D

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000082354
Gene: ENSMUSG00000066442
AA Change: G149D

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 10 198 4.2e-64 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000117314
SMART Domains Protein: ENSMUSP00000112854
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 141 1.6e-45 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127438
SMART Domains Protein: ENSMUSP00000122036
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 70 2.8e-10 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000127868
SMART Domains Protein: ENSMUSP00000118531
Gene: ENSMUSG00000066442

DomainStartEndE-ValueType
Pfam:5-FTHF_cyc-lig 1 113 2.2e-33 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000144930
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147644
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149688
Predicted Effect probably benign
Transcript: ENSMUST00000185894
Predicted Effect noncoding transcript
Transcript: ENSMUST00000186009
Predicted Effect noncoding transcript
Transcript: ENSMUST00000187362
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
MGI Phenotype PHENOTYPE: Mice homozygous for a gene trap allele display embryonic lethality. Heterozygous mice display decreased de novo purine synthesis and reduced plasma folate levels. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Adcyap1r1 G A 6: 55,479,994 V237M probably damaging Het
Akr1c6 T G 13: 4,449,319 probably null Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dhx40 T A 11: 86,804,349 I112L possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Gm8267 G T 14: 44,717,910 T218K possibly damaging Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Hist1h1d T C 13: 23,555,277 probably null Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Nqo2 T C 13: 33,979,556 F22S probably damaging Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Olfr869 T C 9: 20,137,943 S276P probably damaging Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Prokr2 C T 2: 132,373,549 V331M possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Tcaim C T 9: 122,834,779 Q445* probably null Het
Trpc7 T C 13: 56,810,380 probably null Het
Ubxn7 A G 16: 32,384,925 E465G probably damaging Het
Unk G A 11: 116,047,802 R77Q probably damaging Het
Vmn1r226 A T 17: 20,688,289 N261I probably benign Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Yipf2 T C 9: 21,589,848 K85E probably damaging Het
Zfp979 A T 4: 147,613,626 C209S probably benign Het
Other mutations in Mthfs
AlleleSourceChrCoordTypePredicted EffectPPH Score
R0090:Mthfs UTSW 9 89211291 missense probably damaging 1.00
R0099:Mthfs UTSW 9 89226163 intron probably benign
R0837:Mthfs UTSW 9 89215390 missense probably damaging 1.00
R2047:Mthfs UTSW 9 89215303 missense probably damaging 1.00
R4796:Mthfs UTSW 9 89240025 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- GCAGGACTAACAACGTTGCTG -3'
(R):5'- GTAACTTAGGATGCTGGGGAATC -3'

Sequencing Primer
(F):5'- CAACGTTGCTGAAGAATTATTCCC -3'
(R):5'- GCTGGGGAATCTTCATAAAGGACTTC -3'
Posted On2018-06-22