Incidental Mutation 'R6599:Tcaim'
ID525131
Institutional Source Beutler Lab
Gene Symbol Tcaim
Ensembl Gene ENSMUSG00000046603
Gene NameT cell activation inhibitor, mitochondrial
SynonymsLOC382117, D9Ertd402e
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6599 (G1)
Quality Score225.009
Status Validated
Chromosome9
Chromosomal Location122805539-122836334 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 122834779 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 445 (Q445*)
Ref Sequence ENSEMBL: ENSMUSP00000049759 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000052740] [ENSMUST00000136274] [ENSMUST00000203176] [ENSMUST00000203656] [ENSMUST00000204619]
Predicted Effect probably null
Transcript: ENSMUST00000052740
AA Change: Q445*
SMART Domains Protein: ENSMUSP00000049759
Gene: ENSMUSG00000046603
AA Change: Q445*

DomainStartEndE-ValueType
Pfam:DUF4460 33 144 4.2e-40 PFAM
Pfam:DUF4461 199 503 4.1e-124 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000136274
SMART Domains Protein: ENSMUSP00000120948
Gene: ENSMUSG00000046603

DomainStartEndE-ValueType
Pfam:DUF4460 31 125 2.7e-32 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000203176
SMART Domains Protein: ENSMUSP00000145415
Gene: ENSMUSG00000107504

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 75 95 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000203656
SMART Domains Protein: ENSMUSP00000144807
Gene: ENSMUSG00000107504

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 75 95 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000204619
SMART Domains Protein: ENSMUSP00000145500
Gene: ENSMUSG00000107504

DomainStartEndE-ValueType
low complexity region 23 38 N/A INTRINSIC
low complexity region 75 95 N/A INTRINSIC
low complexity region 105 126 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000207349
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Adcyap1r1 G A 6: 55,479,994 V237M probably damaging Het
Akr1c6 T G 13: 4,449,319 probably null Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dhx40 T A 11: 86,804,349 I112L possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Gm8267 G T 14: 44,717,910 T218K possibly damaging Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Hist1h1d T C 13: 23,555,277 probably null Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Mthfs G A 9: 89,239,908 G149D probably damaging Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Nqo2 T C 13: 33,979,556 F22S probably damaging Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Olfr869 T C 9: 20,137,943 S276P probably damaging Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Prokr2 C T 2: 132,373,549 V331M possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Trpc7 T C 13: 56,810,380 probably null Het
Ubxn7 A G 16: 32,384,925 E465G probably damaging Het
Unk G A 11: 116,047,802 R77Q probably damaging Het
Vmn1r226 A T 17: 20,688,289 N261I probably benign Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Yipf2 T C 9: 21,589,848 K85E probably damaging Het
Zfp979 A T 4: 147,613,626 C209S probably benign Het
Other mutations in Tcaim
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01389:Tcaim APN 9 122814562 missense possibly damaging 0.69
IGL01775:Tcaim APN 9 122818825 missense probably damaging 1.00
R1193:Tcaim UTSW 9 122818830 missense probably damaging 0.96
R1487:Tcaim UTSW 9 122818832 nonsense probably null
R1592:Tcaim UTSW 9 122818773 critical splice acceptor site probably null
R1639:Tcaim UTSW 9 122818773 critical splice acceptor site probably null
R1642:Tcaim UTSW 9 122818773 critical splice acceptor site probably null
R1853:Tcaim UTSW 9 122826206 missense probably damaging 1.00
R4204:Tcaim UTSW 9 122833618 missense probably benign 0.01
R4427:Tcaim UTSW 9 122814496 missense probably benign 0.01
R6547:Tcaim UTSW 9 122814466 missense probably benign 0.22
R6906:Tcaim UTSW 9 122834774 missense probably benign 0.01
R7158:Tcaim UTSW 9 122818990 missense possibly damaging 0.66
R7286:Tcaim UTSW 9 122819027 critical splice donor site probably null
Z1088:Tcaim UTSW 9 122833657 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGGAACTCTTGACATGTCTTTTCAC -3'
(R):5'- AGCAGCAGTTAGACACTTTGTTC -3'

Sequencing Primer
(F):5'- AGAGAGTGTACCATCACCC -3'
(R):5'- CAGATATCTGTGTTACTTCATGGC -3'
Posted On2018-06-22