Incidental Mutation 'R6599:Dhx40'
List |< first << previous [record 8 of 39] next >> last >|
ID525135
Institutional Source Beutler Lab
Gene Symbol Dhx40
Ensembl Gene ENSMUSG00000018425
Gene NameDEAH (Asp-Glu-Ala-His) box polypeptide 40
SynonymsARG147, 2410016C14Rik, DDX40
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6599 (G1)
Quality Score225.009
Status Validated
Chromosome11
Chromosomal Location86768846-86807746 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 86804349 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Leucine at position 112 (I112L)
Ref Sequence ENSEMBL: ENSMUSP00000018569 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000018569] [ENSMUST00000148263]
Predicted Effect possibly damaging
Transcript: ENSMUST00000018569
AA Change: I112L

PolyPhen 2 Score 0.511 (Sensitivity: 0.88; Specificity: 0.90)
SMART Domains Protein: ENSMUSP00000018569
Gene: ENSMUSG00000018425
AA Change: I112L

DomainStartEndE-ValueType
DEXDc 47 240 6.32e-33 SMART
HELICc 283 401 3.08e-13 SMART
HA2 462 557 1.92e-21 SMART
Pfam:OB_NTP_bind 588 699 1.7e-20 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000131798
Predicted Effect probably benign
Transcript: ENSMUST00000148263
SMART Domains Protein: ENSMUSP00000114918
Gene: ENSMUSG00000018425

DomainStartEndE-ValueType
Blast:DEXDc 1 96 3e-60 BLAST
SCOP:d1a1va1 4 59 5e-7 SMART
HA2 164 259 1.92e-21 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the DExH/D box family of ATP-dependent RNA helicases that have an essential role in RNA metabolism. Alternate splicing results in multiple transcript variants. A pseudogene of this gene is found on chromosome 17.[provided by RefSeq, Oct 2009]
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Adcyap1r1 G A 6: 55,479,994 V237M probably damaging Het
Akr1c6 T G 13: 4,449,319 probably null Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Gm8267 G T 14: 44,717,910 T218K possibly damaging Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Hist1h1d T C 13: 23,555,277 probably null Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Mthfs G A 9: 89,239,908 G149D probably damaging Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Nqo2 T C 13: 33,979,556 F22S probably damaging Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Olfr869 T C 9: 20,137,943 S276P probably damaging Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Prokr2 C T 2: 132,373,549 V331M possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Tcaim C T 9: 122,834,779 Q445* probably null Het
Trpc7 T C 13: 56,810,380 probably null Het
Ubxn7 A G 16: 32,384,925 E465G probably damaging Het
Unk G A 11: 116,047,802 R77Q probably damaging Het
Vmn1r226 A T 17: 20,688,289 N261I probably benign Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Yipf2 T C 9: 21,589,848 K85E probably damaging Het
Zfp979 A T 4: 147,613,626 C209S probably benign Het
Other mutations in Dhx40
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02366:Dhx40 APN 11 86776702 missense probably damaging 0.98
IGL02818:Dhx40 APN 11 86799505 missense probably benign 0.26
IGL02932:Dhx40 APN 11 86771929 missense probably damaging 1.00
R0312:Dhx40 UTSW 11 86771949 missense probably damaging 0.99
R0485:Dhx40 UTSW 11 86771262 unclassified probably benign
R0542:Dhx40 UTSW 11 86804256 critical splice donor site probably null
R0565:Dhx40 UTSW 11 86771167 missense probably damaging 0.97
R1218:Dhx40 UTSW 11 86799484 missense probably benign 0.13
R1406:Dhx40 UTSW 11 86797745 missense probably benign 0.01
R1406:Dhx40 UTSW 11 86797745 missense probably benign 0.01
R1544:Dhx40 UTSW 11 86806553 missense possibly damaging 0.93
R1550:Dhx40 UTSW 11 86776739 splice site probably null
R1839:Dhx40 UTSW 11 86789297 missense possibly damaging 0.46
R2923:Dhx40 UTSW 11 86789263 missense probably benign 0.26
R3743:Dhx40 UTSW 11 86771159 missense probably damaging 0.99
R3864:Dhx40 UTSW 11 86789245 missense possibly damaging 0.85
R4902:Dhx40 UTSW 11 86771210 missense possibly damaging 0.95
R4918:Dhx40 UTSW 11 86804391 missense possibly damaging 0.85
R5119:Dhx40 UTSW 11 86776636 missense probably damaging 0.99
R5416:Dhx40 UTSW 11 86797691 missense probably benign 0.01
R5531:Dhx40 UTSW 11 86789504 missense possibly damaging 0.45
R5677:Dhx40 UTSW 11 86800963 splice site probably null
R6270:Dhx40 UTSW 11 86799605 missense possibly damaging 0.85
R6431:Dhx40 UTSW 11 86773823 missense probably damaging 0.97
R6456:Dhx40 UTSW 11 86784974 missense probably damaging 1.00
R6594:Dhx40 UTSW 11 86785773 missense possibly damaging 0.74
R7069:Dhx40 UTSW 11 86797743 missense probably benign 0.06
R7268:Dhx40 UTSW 11 86806616 missense possibly damaging 0.86
R7470:Dhx40 UTSW 11 86776702 missense probably damaging 0.98
X0021:Dhx40 UTSW 11 86773814 missense possibly damaging 0.84
X0066:Dhx40 UTSW 11 86806502 missense possibly damaging 0.92
Predicted Primers PCR Primer
(F):5'- GACAAGGCCTTAACAATATGAAAGAA -3'
(R):5'- CTGCAGTATGTTGCTGATCTTG -3'

Sequencing Primer
(F):5'- AGGCCAGTGATAGACCTTATCTC -3'
(R):5'- CAGTATGTTGCTGATCTTGTAGGG -3'
Posted On2018-06-22