Incidental Mutation 'R6599:Akr1c6'
ID525141
Institutional Source Beutler Lab
Gene Symbol Akr1c6
Ensembl Gene ENSMUSG00000021210
Gene Namealdo-keto reductase family 1, member C6
Synonyms3alpha-HSD, estradiol 17-beta-dehydrogenase (A-specific), Hsd17b5, Akr1c1
MMRRC Submission
Accession Numbers

Genbank: NM_030611; MGI: 1933427

Is this an essential gene? Probably non essential (E-score: 0.072) question?
Stock #R6599 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location4434306-4457877 bp(+) (GRCm38)
Type of Mutationunclassified (4 bp from exon)
DNA Base Change (assembly) T to G at 4449319 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000117624 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000021630] [ENSMUST00000156277] [ENSMUST00000220941] [ENSMUST00000223118]
Predicted Effect probably benign
Transcript: ENSMUST00000021630
AA Change: D229E

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
SMART Domains Protein: ENSMUSP00000021630
Gene: ENSMUSG00000021210
AA Change: D229E

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 18 301 2.2e-58 PFAM
Predicted Effect probably null
Transcript: ENSMUST00000156277
SMART Domains Protein: ENSMUSP00000117624
Gene: ENSMUSG00000021210

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 1 173 3e-37 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220941
Predicted Effect probably benign
Transcript: ENSMUST00000223118
AA Change: D51E

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Meta Mutation Damage Score 0.6312 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. These enzymes catalyze the conversion of aldehydes and ketones to their corresponding alcohols by utilizing NADH and/or NADPH as cofactors. The enzymes display overlapping but distinct substrate specificity. This enzyme catalyzes the bioreduction of chlordecone, a toxic organochlorine pesticide, to chlordecone alcohol in liver. This gene shares high sequence identity with three other gene members and is clustered with those three genes at chromosome 10p15-p14. [provided by RefSeq, Jul 2008]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Adcyap1r1 G A 6: 55,479,994 V237M probably damaging Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dhx40 T A 11: 86,804,349 I112L possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Gm8267 G T 14: 44,717,910 T218K possibly damaging Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Hist1h1d T C 13: 23,555,277 probably null Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Mthfs G A 9: 89,239,908 G149D probably damaging Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Nqo2 T C 13: 33,979,556 F22S probably damaging Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Olfr869 T C 9: 20,137,943 S276P probably damaging Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Prokr2 C T 2: 132,373,549 V331M possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Tcaim C T 9: 122,834,779 Q445* probably null Het
Trpc7 T C 13: 56,810,380 probably null Het
Ubxn7 A G 16: 32,384,925 E465G probably damaging Het
Unk G A 11: 116,047,802 R77Q probably damaging Het
Vmn1r226 A T 17: 20,688,289 N261I probably benign Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Yipf2 T C 9: 21,589,848 K85E probably damaging Het
Zfp979 A T 4: 147,613,626 C209S probably benign Het
Other mutations in Akr1c6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00163:Akr1c6 APN 13 4448978 splice site probably benign
IGL01838:Akr1c6 APN 13 4449036 missense probably benign 0.44
IGL02318:Akr1c6 APN 13 4438497 missense probably benign 0.05
IGL02986:Akr1c6 APN 13 4436415 missense probably benign 0.42
IGL03168:Akr1c6 APN 13 4436281 missense probably benign 0.04
IGL03190:Akr1c6 APN 13 4446413 missense possibly damaging 0.49
IGL03258:Akr1c6 APN 13 4436409 missense probably damaging 1.00
R0940:Akr1c6 UTSW 13 4436373 missense probably benign 0.42
R1442:Akr1c6 UTSW 13 4457160 missense probably damaging 1.00
R1624:Akr1c6 UTSW 13 4446364 missense probably benign
R1937:Akr1c6 UTSW 13 4446384 missense probably benign 0.01
R2392:Akr1c6 UTSW 13 4434478 splice site probably null
R2398:Akr1c6 UTSW 13 4449036 missense probably benign 0.44
R4655:Akr1c6 UTSW 13 4449429 missense probably damaging 0.98
R4761:Akr1c6 UTSW 13 4447011 missense probably benign 0.01
R4913:Akr1c6 UTSW 13 4454525 missense probably benign 0.18
R4923:Akr1c6 UTSW 13 4454495 missense probably damaging 1.00
R4953:Akr1c6 UTSW 13 4438609 splice site probably null
R5255:Akr1c6 UTSW 13 4447019 missense probably benign 0.20
R5452:Akr1c6 UTSW 13 4454545 missense probably benign 0.00
R5660:Akr1c6 UTSW 13 4449054 missense probably benign 0.13
R6242:Akr1c6 UTSW 13 4436362 missense probably benign 0.01
R6323:Akr1c6 UTSW 13 4447018 missense possibly damaging 0.91
R6847:Akr1c6 UTSW 13 4438498 nonsense probably null
R6989:Akr1c6 UTSW 13 4449046 missense probably damaging 1.00
R7003:Akr1c6 UTSW 13 4454515 missense probably benign 0.14
R7251:Akr1c6 UTSW 13 4447020 missense probably damaging 1.00
R7310:Akr1c6 UTSW 13 4436355 missense probably benign
X0062:Akr1c6 UTSW 13 4438535 missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTACAGTGCTCTGGGAAGCC -3'
(R):5'- AGCAACTCATCACCTGCATATTCTC -3'

Sequencing Primer
(F):5'- CTCTGGGAAGCCATCGTGAAAAAC -3'
(R):5'- ATCACCTGCATATTCTCTTTTATCC -3'
Posted On2018-06-22