Incidental Mutation 'R6599:Gm8267'
ID525151
Institutional Source Beutler Lab
Gene Symbol Gm8267
Ensembl Gene ENSMUSG00000091923
Gene Namepredicted gene 8267
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.115) question?
Stock #R6599 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location44716838-44750340 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to T at 44717910 bp
ZygosityHeterozygous
Amino Acid Change Threonine to Lysine at position 218 (T218K)
Ref Sequence ENSEMBL: ENSMUSP00000153838 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000165003] [ENSMUST00000169062] [ENSMUST00000226900]
Predicted Effect possibly damaging
Transcript: ENSMUST00000165003
AA Change: T218K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129187
Gene: ENSMUSG00000091923
AA Change: T218K

DomainStartEndE-ValueType
Pfam:Takusan 48 128 1.4e-28 PFAM
coiled coil region 144 175 N/A INTRINSIC
transmembrane domain 238 260 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000169062
AA Change: D157E

PolyPhen 2 Score 0.056 (Sensitivity: 0.94; Specificity: 0.84)
SMART Domains Protein: ENSMUSP00000129402
Gene: ENSMUSG00000091923
AA Change: D157E

DomainStartEndE-ValueType
Pfam:Takusan 46 129 4.9e-37 PFAM
low complexity region 187 199 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000226900
AA Change: T218K

PolyPhen 2 Score 0.861 (Sensitivity: 0.83; Specificity: 0.93)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Adcyap1r1 G A 6: 55,479,994 V237M probably damaging Het
Akr1c6 T G 13: 4,449,319 probably null Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dhx40 T A 11: 86,804,349 I112L possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Hist1h1d T C 13: 23,555,277 probably null Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Mthfs G A 9: 89,239,908 G149D probably damaging Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Nqo2 T C 13: 33,979,556 F22S probably damaging Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Olfr869 T C 9: 20,137,943 S276P probably damaging Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Prokr2 C T 2: 132,373,549 V331M possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Tcaim C T 9: 122,834,779 Q445* probably null Het
Trpc7 T C 13: 56,810,380 probably null Het
Ubxn7 A G 16: 32,384,925 E465G probably damaging Het
Unk G A 11: 116,047,802 R77Q probably damaging Het
Vmn1r226 A T 17: 20,688,289 N261I probably benign Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Yipf2 T C 9: 21,589,848 K85E probably damaging Het
Zfp979 A T 4: 147,613,626 C209S probably benign Het
Other mutations in Gm8267
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01345:Gm8267 APN 14 44724955 missense probably damaging 0.98
IGL02031:Gm8267 APN 14 44717917 missense possibly damaging 0.85
R3619:Gm8267 UTSW 14 44724056 missense possibly damaging 0.95
R4715:Gm8267 UTSW 14 44717835 missense probably benign 0.33
R7001:Gm8267 UTSW 14 44722928 missense possibly damaging 0.94
R7057:Gm8267 UTSW 14 44722024 missense probably damaging 0.99
Z1088:Gm8267 UTSW 14 44724865 missense probably benign 0.28
Predicted Primers PCR Primer
(F):5'- TAGCTCTTGATGTGCCTCAGC -3'
(R):5'- ATGACACTTGGGGATGCAGG -3'

Sequencing Primer
(F):5'- AGCACATGTCTGAATTCCTCTACATG -3'
(R):5'- ATGCAGGGAATGACCTCAGCC -3'
Posted On2018-06-22