Incidental Mutation 'R6599:Ubxn7'
List |< first << previous [record 32 of 39] next >> last >|
ID525153
Institutional Source Beutler Lab
Gene Symbol Ubxn7
Ensembl Gene ENSMUSG00000053774
Gene NameUBX domain protein 7
SynonymsUbxd7
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6599 (G1)
Quality Score225.009
Status Validated
Chromosome16
Chromosomal Location32332257-32393747 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 32384925 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 465 (E465G)
Ref Sequence ENSEMBL: ENSMUSP00000156376 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000115151] [ENSMUST00000232137]
Predicted Effect probably damaging
Transcript: ENSMUST00000115151
AA Change: E487G

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000110804
Gene: ENSMUSG00000053774
AA Change: E487G

DomainStartEndE-ValueType
low complexity region 2 12 N/A INTRINSIC
Pfam:UBA_4 15 56 4.3e-15 PFAM
UAS 137 260 3.05e-50 SMART
low complexity region 312 328 N/A INTRINSIC
UBX 405 487 1.16e-15 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000232137
AA Change: E465G

PolyPhen 2 Score 0.999 (Sensitivity: 0.14; Specificity: 0.99)
Meta Mutation Damage Score 0.408 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.7%
  • 10x: 98.6%
  • 20x: 95.9%
Validation Efficiency 94% (32/34)
Allele List at MGI
Other mutations in this stock
Total: 38 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930579F01Rik T C 3: 138,176,489 H150R probably benign Het
Acbd5 C T 2: 23,069,080 probably benign Het
Adcyap1r1 G A 6: 55,479,994 V237M probably damaging Het
Akr1c6 T G 13: 4,449,319 probably null Het
BC037034 G T 5: 138,263,458 probably null Het
Ccdc7b T A 8: 129,166,981 F96L probably benign Het
Cubn T C 2: 13,310,673 H2983R possibly damaging Het
Dhx40 T A 11: 86,804,349 I112L possibly damaging Het
Dnmbp A T 19: 43,856,586 D1070E probably damaging Het
Eml2 G A 7: 19,201,163 V432I probably damaging Het
Ep300 G C 15: 81,586,713 D29H unknown Het
Exoc3 T C 13: 74,189,158 probably null Het
Fuk A T 8: 110,893,283 probably null Het
Gm6401 C A 14: 41,966,864 E83* probably null Het
Gm8267 G T 14: 44,717,910 T218K possibly damaging Het
Hif3a T A 7: 17,042,605 D470V possibly damaging Het
Hist1h1d T C 13: 23,555,277 probably null Het
Igf2r T C 17: 12,698,618 S1526G possibly damaging Het
Lrp2 T C 2: 69,469,405 D3101G probably damaging Het
Megf6 A G 4: 154,258,087 probably null Het
Mthfs G A 9: 89,239,908 G149D probably damaging Het
Nnmt T C 9: 48,603,369 D116G probably benign Het
Nqo2 T C 13: 33,979,556 F22S probably damaging Het
Olfr389 T A 11: 73,776,680 M216L probably benign Het
Olfr869 T C 9: 20,137,943 S276P probably damaging Het
Parm1 T C 5: 91,593,859 S29P possibly damaging Het
Prokr2 C T 2: 132,373,549 V331M possibly damaging Het
Ptch1 T A 13: 63,523,104 I871F probably damaging Het
Rps6ka5 C A 12: 100,597,909 G227V probably damaging Het
Tcaim C T 9: 122,834,779 Q445* probably null Het
Trpc7 T C 13: 56,810,380 probably null Het
Unk G A 11: 116,047,802 R77Q probably damaging Het
Vmn1r226 A T 17: 20,688,289 N261I probably benign Het
Vmn1r87 T A 7: 13,131,959 K134* probably null Het
Vmn2r10 T A 5: 108,996,078 I669L probably benign Het
Vmn2r115 A G 17: 23,346,032 I298V probably benign Het
Yipf2 T C 9: 21,589,848 K85E probably damaging Het
Zfp979 A T 4: 147,613,626 C209S probably benign Het
Other mutations in Ubxn7
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00821:Ubxn7 APN 16 32369398 missense probably damaging 0.97
IGL02149:Ubxn7 APN 16 32375270 missense probably damaging 1.00
IGL02183:Ubxn7 APN 16 32369383 missense probably damaging 1.00
IGL02690:Ubxn7 APN 16 32381605 missense probably benign 0.01
IGL03133:Ubxn7 APN 16 32381781 missense probably damaging 1.00
R0268:Ubxn7 UTSW 16 32360046 missense probably benign 0.05
R0583:Ubxn7 UTSW 16 32375914 missense probably damaging 1.00
R0635:Ubxn7 UTSW 16 32367417 intron probably benign
R0787:Ubxn7 UTSW 16 32381763 splice site probably benign
R1658:Ubxn7 UTSW 16 32381236 intron probably null
R1916:Ubxn7 UTSW 16 32381759 splice site probably benign
R2070:Ubxn7 UTSW 16 32372469 missense possibly damaging 0.47
R2071:Ubxn7 UTSW 16 32372469 missense possibly damaging 0.47
R3031:Ubxn7 UTSW 16 32375307 missense probably benign 0.34
R3871:Ubxn7 UTSW 16 32381430 missense possibly damaging 0.94
R4994:Ubxn7 UTSW 16 32381504 missense probably damaging 1.00
R5629:Ubxn7 UTSW 16 32332299 missense unknown
R6334:Ubxn7 UTSW 16 32372189 unclassified probably null
Predicted Primers PCR Primer
(F):5'- ACTCATAAACTAGTCGTCATGGAG -3'
(R):5'- GAAGGAGACTGATTTACACGTGAC -3'

Sequencing Primer
(F):5'- ACTAGTCGTCATGGAGTTTATTTCC -3'
(R):5'- ACTGATTTACACGTGACAGAAAG -3'
Posted On2018-06-22