Incidental Mutation 'R6600:Olfr1200'
ID525171
Institutional Source Beutler Lab
Gene Symbol Olfr1200
Ensembl Gene ENSMUSG00000075115
Gene Nameolfactory receptor 1200
SynonymsMOR225-12, GA_x6K02T2Q125-50243231-50242221
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.055) question?
Stock #R6600 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location88763511-88770488 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 88767757 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 186 (V186A)
Ref Sequence ENSEMBL: ENSMUSP00000149757 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000099811] [ENSMUST00000217588]
Predicted Effect probably benign
Transcript: ENSMUST00000099811
AA Change: V186A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
SMART Domains Protein: ENSMUSP00000097399
Gene: ENSMUSG00000075115
AA Change: V186A

DomainStartEndE-ValueType
Pfam:7tm_4 29 302 3.2e-47 PFAM
Pfam:7tm_1 39 285 2.3e-19 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000217588
AA Change: V186A

PolyPhen 2 Score 0.023 (Sensitivity: 0.95; Specificity: 0.81)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
MGI Phenotype FUNCTION: Olfactory receptors interact with odorant molecules in the nose, to initiate a neuronal response that triggers the perception of a smell. The olfactory receptor proteins are members of a large family of G-protein-coupled receptors (GPCR) arising from single coding-exon genes. Olfactory receptors share a 7-transmembrane domain structure with many neurotransmitter and hormone receptors and are responsible for the recognition and G protein-mediated transduction of odorant signals. The olfactory receptor gene family is the largest in the genome. The nomenclature assigned to the olfactory receptor genes and proteins for this organism is independent of other organisms. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A430033K04Rik ACGC ACGCGC 5: 138,647,448 probably null Het
Adam1b C T 5: 121,501,467 C505Y probably damaging Het
Adam24 C A 8: 40,680,548 H352N probably damaging Het
Bcl6b A T 11: 70,229,128 L11Q probably damaging Het
C2cd5 A T 6: 143,079,976 V165E probably damaging Het
Cacna1d T C 14: 30,114,235 N852S probably benign Het
Cd320 T C 17: 33,847,617 C110R probably damaging Het
Clasrp T A 7: 19,590,282 K223* probably null Het
Col5a1 C A 2: 27,997,571 N951K unknown Het
Csn2 T C 5: 87,694,632 T171A probably benign Het
Dse A G 10: 34,152,541 I851T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fbxo24 T A 5: 137,612,873 I413F probably damaging Het
Flywch2 C A 17: 23,778,110 G109V possibly damaging Het
Fnip1 A G 11: 54,503,099 D787G probably benign Het
Gm12184 A C 11: 48,826,288 V21G probably damaging Het
Gramd1c T A 16: 44,040,119 R72* probably null Het
Hspd1 T C 1: 55,078,618 I494V probably benign Het
Limch1 T C 5: 66,745,938 V10A probably benign Het
Lrrfip1 C T 1: 91,115,847 S658F probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Naip1 C T 13: 100,423,158 G1113S probably benign Het
Nlrc3 A G 16: 3,965,074 I157T probably benign Het
Pdlim5 T C 3: 142,259,278 R126G probably damaging Het
Pgm2 C T 4: 99,967,062 R311* probably null Het
Ptcd3 T C 6: 71,883,546 Y559C probably damaging Het
Robo1 T C 16: 72,989,655 S852P probably damaging Het
Rps6kb2 A T 19: 4,158,851 M259K probably damaging Het
Sema4b T C 7: 80,212,928 L84P probably benign Het
Slf1 A C 13: 77,083,536 S575A probably benign Het
Tjap1 T C 17: 46,259,998 N173S probably damaging Het
Trpm1 T A 7: 64,154,033 M1K probably null Het
Ubr1 C A 2: 120,915,399 K851N probably benign Het
Zfp568 C A 7: 30,022,523 R298S possibly damaging Het
Other mutations in Olfr1200
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01375:Olfr1200 APN 2 88767466 missense probably benign 0.01
PIT4520001:Olfr1200 UTSW 2 88767577 missense possibly damaging 0.95
R0375:Olfr1200 UTSW 2 88767641 missense possibly damaging 0.77
R0525:Olfr1200 UTSW 2 88767314 nonsense probably null
R1467:Olfr1200 UTSW 2 88767488 missense probably benign 0.02
R1467:Olfr1200 UTSW 2 88767488 missense probably benign 0.02
R1613:Olfr1200 UTSW 2 88767805 missense probably damaging 1.00
R2224:Olfr1200 UTSW 2 88767586 missense possibly damaging 0.89
R2760:Olfr1200 UTSW 2 88767636 missense possibly damaging 0.61
R3434:Olfr1200 UTSW 2 88768069 missense probably damaging 1.00
R6156:Olfr1200 UTSW 2 88767590 missense probably benign 0.01
R6251:Olfr1200 UTSW 2 88768288 missense probably damaging 1.00
R6582:Olfr1200 UTSW 2 88768243 missense probably damaging 0.96
R6592:Olfr1200 UTSW 2 88768127 missense probably damaging 1.00
R6774:Olfr1200 UTSW 2 88767884 missense probably benign 0.00
R7140:Olfr1200 UTSW 2 88767964 missense probably damaging 1.00
X0026:Olfr1200 UTSW 2 88767433 missense probably benign
Predicted Primers PCR Primer
(F):5'- ACCATTATGTGTGAACTACAGGTAG -3'
(R):5'- TTCATCCTGGTGTCCATGGC -3'

Sequencing Primer
(F):5'- ACTACAGGTAGAGAGTGCTTTCC -3'
(R):5'- GACCGCTATGTTGCCATTGTCAAG -3'
Posted On2018-06-22