Mutagenetix > Incidental Mutation

Incidental Mutation 'R6600:Ubr1'

525173

Institutional Source

Beutler Lab

Gene Symbol

Ubr1

Ensembl Gene

ENSMUSG00000027272

Gene Name

ubiquitin protein ligase E3 component n-recognin 1

Synonyms

E3 alpha

MMRRC Submission

044724-MU

Accession Numbers

Essential gene?

Probably essential (E-score: 0.833) question?

Stock #

R6600 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

120690750-120801196 bp(-) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 120745880 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Lysine to Asparagine at position 851 (K851N)

Ref Sequence

ENSEMBL: ENSMUSP00000028728 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000028728]

AlphaFold

O70481

Predicted Effect

probably benign
Transcript: ENSMUST00000028728
AA Change: K851N

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)

SMART Domains

Protein: ENSMUSP00000028728
Gene: ENSMUSG00000027272
AA Change: K851N

Domain	Start	End	E-Value	Type
ZnF_UBR1	97	167	1.24e-35	SMART
Pfam:ClpS	221	301	8e-24	PFAM
low complexity region	918	936	N/A	INTRINSIC
low complexity region	1017	1030	N/A	INTRINSIC
low complexity region	1070	1081	N/A	INTRINSIC
Blast:RING	1101	1203	4e-34	BLAST

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000129790

Meta Mutation Damage Score

0.0601

Coding Region Coverage

1x: 99.9%
3x: 99.6%
10x: 98.2%
20x: 94.6%

Validation Efficiency

100% (33/33)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The N-end rule pathway is one proteolytic pathway of the ubiquitin system. The recognition component of this pathway, encoded by this gene, binds to a destabilizing N-terminal residue of a substrate protein and participates in the formation of a substrate-linked multiubiquitin chain. This leads to the eventual degradation of the substrate protein. The protein described in this record has a RING-type zinc finger and a UBR-type zinc finger. Mutations in this gene have been associated with Johanson-Blizzard syndrome. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants have 20% lower body weight and reduced muscle and adipose tissue. Skeletal muscle lacks a mechanism for targeting proteins for rapid catabolism. Aberrant regulation of fatty acid synthase upon starvation is also observed. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
A430033K04Rik	ACGC	ACGCGC	5: 138,645,710 (GRCm39)		probably null	Het
Adam1b	C	T	5: 121,639,530 (GRCm39)	C505Y	probably damaging	Het
Adam24	C	A	8: 41,133,587 (GRCm39)	H352N	probably damaging	Het
Bcl6b	A	T	11: 70,119,954 (GRCm39)	L11Q	probably damaging	Het
C2cd5	A	T	6: 143,025,702 (GRCm39)	V165E	probably damaging	Het
Cacna1d	T	C	14: 29,836,192 (GRCm39)	N852S	probably benign	Het
Cd320	T	C	17: 34,066,591 (GRCm39)	C110R	probably damaging	Het
Cdk2ap1rt	A	C	11: 48,717,115 (GRCm39)	V21G	probably damaging	Het
Clasrp	T	A	7: 19,324,207 (GRCm39)	K223*	probably null	Het
Col5a1	C	A	2: 27,887,583 (GRCm39)	N951K	unknown	Het
Csn2	T	C	5: 87,842,491 (GRCm39)	T171A	probably benign	Het
Dse	A	G	10: 34,028,537 (GRCm39)	I851T	probably benign	Het
Fam168b	C	A	1: 34,875,822 (GRCm39)	G21V	probably damaging	Het
Fbxo24	T	A	5: 137,611,135 (GRCm39)	I413F	probably damaging	Het
Flywch2	C	A	17: 23,997,084 (GRCm39)	G109V	possibly damaging	Het
Fnip1	A	G	11: 54,393,925 (GRCm39)	D787G	probably benign	Het
Gramd1c	T	A	16: 43,860,482 (GRCm39)	R72*	probably null	Het
Hspd1	T	C	1: 55,117,777 (GRCm39)	I494V	probably benign	Het
Limch1	T	C	5: 66,903,281 (GRCm39)	V10A	probably benign	Het
Lrrfip1	C	T	1: 91,043,569 (GRCm39)	S658F	probably damaging	Het
Naip1	G	A	13: 100,559,578 (GRCm39)	S1142F	probably benign	Het
Naip1	C	T	13: 100,559,666 (GRCm39)	G1113S	probably benign	Het
Nlrc3	A	G	16: 3,782,938 (GRCm39)	I157T	probably benign	Het
Or4a67	A	G	2: 88,598,101 (GRCm39)	V186A	probably benign	Het
Pdlim5	T	C	3: 141,965,039 (GRCm39)	R126G	probably damaging	Het
Pgm1	C	T	4: 99,824,259 (GRCm39)	R311*	probably null	Het
Ptcd3	T	C	6: 71,860,530 (GRCm39)	Y559C	probably damaging	Het
Robo1	T	C	16: 72,786,543 (GRCm39)	S852P	probably damaging	Het
Rps6kb2	A	T	19: 4,208,850 (GRCm39)	M259K	probably damaging	Het
Sema4b	T	C	7: 79,862,676 (GRCm39)	L84P	probably benign	Het
Slf1	A	C	13: 77,231,655 (GRCm39)	S575A	probably benign	Het
Tjap1	T	C	17: 46,570,924 (GRCm39)	N173S	probably damaging	Het
Trpm1	T	A	7: 63,803,781 (GRCm39)	M1K	probably null	Het
Zfp568	C	A	7: 29,721,948 (GRCm39)	R298S	possibly damaging	Het

Other mutations in Ubr1

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00552:Ubr1	APN	2	120,705,888 (GRCm39)	missense	possibly damaging	0.65
IGL00570:Ubr1	APN	2	120,771,574 (GRCm39)	missense	possibly damaging	0.93
IGL00990:Ubr1	APN	2	120,761,353 (GRCm39)	missense	probably damaging	1.00
IGL01124:Ubr1	APN	2	120,745,386 (GRCm39)	missense	probably benign
IGL01346:Ubr1	APN	2	120,703,603 (GRCm39)	critical splice donor site	probably null
IGL01368:Ubr1	APN	2	120,771,612 (GRCm39)	splice site	probably benign
IGL01539:Ubr1	APN	2	120,756,494 (GRCm39)	missense	possibly damaging	0.79
IGL01862:Ubr1	APN	2	120,764,823 (GRCm39)	missense	possibly damaging	0.81
IGL01965:Ubr1	APN	2	120,705,879 (GRCm39)	missense	probably damaging	0.99
IGL01984:Ubr1	APN	2	120,751,867 (GRCm39)	missense	probably damaging	0.99
IGL02184:Ubr1	APN	2	120,730,989 (GRCm39)	missense	probably benign	0.00
IGL02208:Ubr1	APN	2	120,776,830 (GRCm39)	missense	probably benign	0.00
IGL02415:Ubr1	APN	2	120,801,084 (GRCm39)	utr 5 prime	probably benign
IGL02517:Ubr1	APN	2	120,694,854 (GRCm39)	missense	possibly damaging	0.69
IGL02614:Ubr1	APN	2	120,701,460 (GRCm39)	splice site	probably benign
IGL02627:Ubr1	APN	2	120,771,472 (GRCm39)	missense	probably damaging	1.00
IGL02718:Ubr1	APN	2	120,745,364 (GRCm39)	missense	probably damaging	1.00
IGL02741:Ubr1	APN	2	120,771,572 (GRCm39)	missense	probably benign	0.01
IGL02939:Ubr1	APN	2	120,711,664 (GRCm39)	critical splice acceptor site	probably null
IGL03081:Ubr1	APN	2	120,791,637 (GRCm39)	missense	possibly damaging	0.83
IGL03310:Ubr1	APN	2	120,694,898 (GRCm39)	missense	probably damaging	1.00
IGL03370:Ubr1	APN	2	120,725,641 (GRCm39)	missense	probably benign
I1329:Ubr1	UTSW	2	120,764,775 (GRCm39)	splice site	probably benign
R0022:Ubr1	UTSW	2	120,791,654 (GRCm39)	splice site	probably benign
R0345:Ubr1	UTSW	2	120,734,584 (GRCm39)	splice site	probably null
R0373:Ubr1	UTSW	2	120,777,138 (GRCm39)	missense	probably benign	0.01
R0393:Ubr1	UTSW	2	120,737,427 (GRCm39)	missense	probably damaging	1.00
R0543:Ubr1	UTSW	2	120,711,574 (GRCm39)	missense	probably damaging	1.00
R0559:Ubr1	UTSW	2	120,778,364 (GRCm39)	nonsense	probably null
R0723:Ubr1	UTSW	2	120,711,582 (GRCm39)	nonsense	probably null
R1178:Ubr1	UTSW	2	120,756,510 (GRCm39)	nonsense	probably null
R1401:Ubr1	UTSW	2	120,786,125 (GRCm39)	missense	probably benign	0.01
R1485:Ubr1	UTSW	2	120,791,579 (GRCm39)	missense	probably benign	0.03
R1572:Ubr1	UTSW	2	120,765,800 (GRCm39)	splice site	probably benign
R1920:Ubr1	UTSW	2	120,761,449 (GRCm39)	missense	probably benign	0.11
R1921:Ubr1	UTSW	2	120,761,449 (GRCm39)	missense	probably benign	0.11
R1997:Ubr1	UTSW	2	120,776,754 (GRCm39)	critical splice donor site	probably null
R2129:Ubr1	UTSW	2	120,773,034 (GRCm39)	missense	probably benign	0.35
R2147:Ubr1	UTSW	2	120,694,811 (GRCm39)	missense	probably damaging	1.00
R2191:Ubr1	UTSW	2	120,756,528 (GRCm39)	missense	probably damaging	0.96
R2288:Ubr1	UTSW	2	120,739,963 (GRCm39)	missense	probably damaging	1.00
R3409:Ubr1	UTSW	2	120,793,929 (GRCm39)	missense	probably benign	0.02
R3930:Ubr1	UTSW	2	120,746,951 (GRCm39)	missense	probably benign	0.20
R3979:Ubr1	UTSW	2	120,693,168 (GRCm39)	missense	probably benign	0.11
R4172:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4173:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4174:Ubr1	UTSW	2	120,777,103 (GRCm39)	splice site	probably null
R4241:Ubr1	UTSW	2	120,764,867 (GRCm39)	missense	possibly damaging	0.69
R4366:Ubr1	UTSW	2	120,801,084 (GRCm39)	utr 5 prime	probably benign
R4371:Ubr1	UTSW	2	120,725,547 (GRCm39)	splice site	probably null
R4449:Ubr1	UTSW	2	120,776,862 (GRCm39)	missense	possibly damaging	0.84
R4533:Ubr1	UTSW	2	120,772,963 (GRCm39)	missense	possibly damaging	0.86
R4656:Ubr1	UTSW	2	120,756,494 (GRCm39)	missense	probably benign	0.35
R4765:Ubr1	UTSW	2	120,793,923 (GRCm39)	nonsense	probably null
R4928:Ubr1	UTSW	2	120,745,419 (GRCm39)	missense	probably damaging	1.00
R4987:Ubr1	UTSW	2	120,794,047 (GRCm39)	missense	probably benign	0.00
R5033:Ubr1	UTSW	2	120,742,478 (GRCm39)	critical splice donor site	probably null
R5108:Ubr1	UTSW	2	120,793,903 (GRCm39)	missense	probably benign	0.20
R5118:Ubr1	UTSW	2	120,712,745 (GRCm39)	missense	probably benign	0.20
R5211:Ubr1	UTSW	2	120,723,651 (GRCm39)	missense	possibly damaging	0.92
R5215:Ubr1	UTSW	2	120,734,525 (GRCm39)	missense	probably benign	0.00
R5449:Ubr1	UTSW	2	120,793,981 (GRCm39)	missense	probably benign
R5452:Ubr1	UTSW	2	120,698,783 (GRCm39)	missense	possibly damaging	0.95
R5582:Ubr1	UTSW	2	120,745,888 (GRCm39)	missense	probably benign
R5610:Ubr1	UTSW	2	120,722,593 (GRCm39)	missense	probably benign	0.04
R5637:Ubr1	UTSW	2	120,793,998 (GRCm39)	missense	possibly damaging	0.68
R5808:Ubr1	UTSW	2	120,791,573 (GRCm39)	missense	possibly damaging	0.63
R5845:Ubr1	UTSW	2	120,734,486 (GRCm39)	missense	probably benign
R5979:Ubr1	UTSW	2	120,776,863 (GRCm39)	missense	probably benign	0.07
R6044:Ubr1	UTSW	2	120,693,202 (GRCm39)	missense	probably benign	0.38
R6146:Ubr1	UTSW	2	120,723,690 (GRCm39)	missense	probably damaging	0.98
R6252:Ubr1	UTSW	2	120,737,376 (GRCm39)	missense	probably benign	0.21
R6389:Ubr1	UTSW	2	120,711,520 (GRCm39)	missense	probably benign	0.03
R6670:Ubr1	UTSW	2	120,754,611 (GRCm39)	critical splice donor site	probably null
R6731:Ubr1	UTSW	2	120,786,121 (GRCm39)	missense	probably null	0.99
R6836:Ubr1	UTSW	2	120,727,156 (GRCm39)	splice site	probably null
R6994:Ubr1	UTSW	2	120,794,074 (GRCm39)	missense	probably benign
R7121:Ubr1	UTSW	2	120,705,979 (GRCm39)	missense	probably benign	0.00
R7204:Ubr1	UTSW	2	120,734,558 (GRCm39)	missense	possibly damaging	0.49
R7209:Ubr1	UTSW	2	120,693,246 (GRCm39)	missense	probably benign	0.04
R7434:Ubr1	UTSW	2	120,693,161 (GRCm39)	missense	probably benign
R7457:Ubr1	UTSW	2	120,748,309 (GRCm39)	missense	probably benign	0.35
R7464:Ubr1	UTSW	2	120,720,255 (GRCm39)	critical splice donor site	probably null
R7519:Ubr1	UTSW	2	120,705,925 (GRCm39)	missense	possibly damaging	0.63
R7574:Ubr1	UTSW	2	120,703,672 (GRCm39)	missense	possibly damaging	0.93
R8030:Ubr1	UTSW	2	120,764,855 (GRCm39)	missense	probably damaging	0.99
R8085:Ubr1	UTSW	2	120,764,898 (GRCm39)	nonsense	probably null
R8221:Ubr1	UTSW	2	120,791,585 (GRCm39)	missense	probably damaging	0.97
R8241:Ubr1	UTSW	2	120,793,937 (GRCm39)	missense	possibly damaging	0.80
R8291:Ubr1	UTSW	2	120,741,596 (GRCm39)	missense	probably benign
R8293:Ubr1	UTSW	2	120,693,202 (GRCm39)	missense	probably benign	0.38
R8420:Ubr1	UTSW	2	120,701,476 (GRCm39)	missense	probably benign
R8489:Ubr1	UTSW	2	120,711,548 (GRCm39)	missense	probably benign	0.42
R8708:Ubr1	UTSW	2	120,696,964 (GRCm39)	missense	probably benign	0.27
R8856:Ubr1	UTSW	2	120,734,523 (GRCm39)	missense	probably damaging	1.00
R8995:Ubr1	UTSW	2	120,697,034 (GRCm39)	missense	probably damaging	1.00
R9153:Ubr1	UTSW	2	120,756,469 (GRCm39)	missense	probably benign	0.00
R9155:Ubr1	UTSW	2	120,754,615 (GRCm39)	missense	possibly damaging	0.84
R9156:Ubr1	UTSW	2	120,703,603 (GRCm39)	critical splice donor site	probably null
R9194:Ubr1	UTSW	2	120,778,325 (GRCm39)	missense	probably damaging	1.00
R9320:Ubr1	UTSW	2	120,727,000 (GRCm39)	missense	probably benign	0.04
R9401:Ubr1	UTSW	2	120,765,765 (GRCm39)	missense	probably benign	0.06
R9430:Ubr1	UTSW	2	120,734,506 (GRCm39)	missense	possibly damaging	0.59
R9515:Ubr1	UTSW	2	120,703,627 (GRCm39)	missense	probably damaging	1.00
R9623:Ubr1	UTSW	2	120,764,820 (GRCm39)	missense	probably benign	0.06
R9703:Ubr1	UTSW	2	120,732,092 (GRCm39)	missense	probably damaging	1.00

Predicted Primers

PCR Primer
(F):5'- GGCTCTCACTCATGTTGGAC -3'
(R):5'- GACTCAAAGAACAGAGGCTAAGTTC -3'

Sequencing Primer
(F):5'- GCTCTCACTCATGTTGGACACATC -3'
(R):5'- GTGGTGCCTTCTCTAAGACAAC -3'

Posted On

2018-06-22