Incidental Mutation 'R6600:A430033K04Rik'
List |< first << previous [record 37 of 1259] next >> last >|
ID525188
Institutional Source Beutler Lab
Gene Symbol A430033K04Rik
Ensembl Gene ENSMUSG00000056014
Gene NameRIKEN cDNA A430033K04 gene
Synonyms
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.093) question?
Stock #R6600 (G1)
Quality Score217.468
Status Validated
Chromosome5
Chromosomal Location138622859-138652414 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) ACGC to ACGCGC at 138647448 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000142904 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000069862] [ENSMUST00000198958]
Predicted Effect probably null
Transcript: ENSMUST00000069862
SMART Domains Protein: ENSMUSP00000067316
Gene: ENSMUSG00000056014

DomainStartEndE-ValueType
KRAB 16 76 6.23e-34 SMART
ZnF_C2H2 261 280 1.01e2 SMART
ZnF_C2H2 455 477 1.47e-3 SMART
ZnF_C2H2 483 505 4.05e-1 SMART
ZnF_C2H2 511 533 5.5e-3 SMART
ZnF_C2H2 539 561 7.26e-3 SMART
ZnF_C2H2 567 589 5.14e-3 SMART
ZnF_C2H2 595 617 3.63e-3 SMART
ZnF_C2H2 623 645 1.92e-2 SMART
ZnF_C2H2 651 673 2.12e-4 SMART
Predicted Effect probably null
Transcript: ENSMUST00000198958
SMART Domains Protein: ENSMUSP00000142904
Gene: ENSMUSG00000056014

DomainStartEndE-ValueType
KRAB 16 76 2.7e-36 SMART
ZnF_C2H2 261 280 4.2e-1 SMART
ZnF_C2H2 455 477 6.4e-6 SMART
ZnF_C2H2 483 505 1.8e-3 SMART
ZnF_C2H2 511 533 2.3e-5 SMART
ZnF_C2H2 539 561 3e-5 SMART
ZnF_C2H2 567 589 2.1e-5 SMART
ZnF_C2H2 595 617 1.5e-5 SMART
ZnF_C2H2 623 643 2.7e-1 SMART
Meta Mutation Damage Score 0.6572 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.6%
Validation Efficiency 100% (33/33)
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam1b C T 5: 121,501,467 C505Y probably damaging Het
Adam24 C A 8: 40,680,548 H352N probably damaging Het
Bcl6b A T 11: 70,229,128 L11Q probably damaging Het
C2cd5 A T 6: 143,079,976 V165E probably damaging Het
Cacna1d T C 14: 30,114,235 N852S probably benign Het
Cd320 T C 17: 33,847,617 C110R probably damaging Het
Clasrp T A 7: 19,590,282 K223* probably null Het
Col5a1 C A 2: 27,997,571 N951K unknown Het
Csn2 T C 5: 87,694,632 T171A probably benign Het
Dse A G 10: 34,152,541 I851T probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fbxo24 T A 5: 137,612,873 I413F probably damaging Het
Flywch2 C A 17: 23,778,110 G109V possibly damaging Het
Fnip1 A G 11: 54,503,099 D787G probably benign Het
Gm12184 A C 11: 48,826,288 V21G probably damaging Het
Gramd1c T A 16: 44,040,119 R72* probably null Het
Hspd1 T C 1: 55,078,618 I494V probably benign Het
Limch1 T C 5: 66,745,938 V10A probably benign Het
Lrrfip1 C T 1: 91,115,847 S658F probably damaging Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Naip1 C T 13: 100,423,158 G1113S probably benign Het
Nlrc3 A G 16: 3,965,074 I157T probably benign Het
Olfr1200 A G 2: 88,767,757 V186A probably benign Het
Pdlim5 T C 3: 142,259,278 R126G probably damaging Het
Pgm2 C T 4: 99,967,062 R311* probably null Het
Ptcd3 T C 6: 71,883,546 Y559C probably damaging Het
Robo1 T C 16: 72,989,655 S852P probably damaging Het
Rps6kb2 A T 19: 4,158,851 M259K probably damaging Het
Sema4b T C 7: 80,212,928 L84P probably benign Het
Slf1 A C 13: 77,083,536 S575A probably benign Het
Tjap1 T C 17: 46,259,998 N173S probably damaging Het
Trpm1 T A 7: 64,154,033 M1K probably null Het
Ubr1 C A 2: 120,915,399 K851N probably benign Het
Zfp568 C A 7: 30,022,523 R298S possibly damaging Het
Other mutations in A430033K04Rik
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00089:A430033K04Rik APN 5 138647592 missense probably damaging 1.00
IGL00336:A430033K04Rik APN 5 138647104 missense probably damaging 0.99
IGL02615:A430033K04Rik APN 5 138646140 nonsense probably null
IGL03354:A430033K04Rik APN 5 138646779 missense possibly damaging 0.85
R0172:A430033K04Rik UTSW 5 138647316 missense probably damaging 0.99
R1769:A430033K04Rik UTSW 5 138646257 missense probably benign 0.04
R4515:A430033K04Rik UTSW 5 138647744 missense probably damaging 1.00
R4903:A430033K04Rik UTSW 5 138646857 nonsense probably null
R4964:A430033K04Rik UTSW 5 138646857 nonsense probably null
R5389:A430033K04Rik UTSW 5 138646297 missense probably benign 0.02
R5769:A430033K04Rik UTSW 5 138646333 missense possibly damaging 0.86
R6128:A430033K04Rik UTSW 5 138647776 missense probably damaging 1.00
R6399:A430033K04Rik UTSW 5 138647559 missense probably damaging 1.00
R6444:A430033K04Rik UTSW 5 138639569 small deletion probably benign
R6774:A430033K04Rik UTSW 5 138646450 missense probably benign
Predicted Primers PCR Primer
(F):5'- TCTACGTTTCAAGCCCCACG -3'
(R):5'- GCATCAGTTGGGACTTACGAGAG -3'

Sequencing Primer
(F):5'- GTCTGAAGACTTTCTCCCACAAG -3'
(R):5'- CTTACGAGAGAAAGCTTTCCTGC -3'
Posted On2018-06-22