Incidental Mutation 'R6632:Akr1b1'
ID 525217
Institutional Source Beutler Lab
Gene Symbol Akr1b1
Ensembl Gene ENSMUSG00000001642
Gene Name aldo-keto reductase family 1 member B
Synonyms Aldr1, Ahr1, AR, Ahr-1, Akr1b3, ALR2, Aldor1
MMRRC Submission 044754-MU
Accession Numbers
Essential gene? Possibly non essential (E-score: 0.349) question?
Stock # R6632 (G1)
Quality Score 101.008
Status Validated
Chromosome 6
Chromosomal Location 34280865-34294424 bp(-) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) C to T at 34286939 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Valine to Methionine at position 206 (V206M)
Ref Sequence ENSEMBL: ENSMUSP00000100045 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000102980] [ENSMUST00000154655]
AlphaFold P45376
Predicted Effect possibly damaging
Transcript: ENSMUST00000102980
AA Change: V206M

PolyPhen 2 Score 0.561 (Sensitivity: 0.88; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000100045
Gene: ENSMUSG00000001642
AA Change: V206M

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 13 294 4.1e-56 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000126991
Predicted Effect noncoding transcript
Transcript: ENSMUST00000136559
Predicted Effect noncoding transcript
Transcript: ENSMUST00000138275
Predicted Effect noncoding transcript
Transcript: ENSMUST00000142761
Predicted Effect probably benign
Transcript: ENSMUST00000154655
SMART Domains Protein: ENSMUSP00000114391
Gene: ENSMUSG00000001642

DomainStartEndE-ValueType
Pfam:Aldo_ket_red 15 176 9.2e-27 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000201392
Meta Mutation Damage Score 0.0747 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.1%
  • 20x: 94.3%
Validation Efficiency 100% (38/38)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the aldo/keto reductase superfamily, which consists of more than 40 known enzymes and proteins. This member catalyzes the reduction of a number of aldehydes, including the aldehyde form of glucose, and is thereby implicated in the development of diabetic complications by catalyzing the reduction of glucose to sorbitol. Multiple pseudogenes have been identified for this gene. The nomenclature system used by the HUGO Gene Nomenclature Committee to define human aldo-keto reductase family members is known to differ from that used by the Mouse Genome Informatics database. [provided by RefSeq, Feb 2009]
PHENOTYPE: Homozygous mutation of this gene results in increased drinking, increased urination, and dilation of the renal tubules. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 37 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T C 13: 77,429,186 (GRCm39) S758P possibly damaging Het
Abca3 C G 17: 24,603,444 (GRCm39) D545E probably benign Het
Akap9 T A 5: 4,063,842 (GRCm39) probably null Het
Arpp21 G A 9: 111,956,424 (GRCm39) Q518* probably null Het
Atp9b G A 18: 80,851,864 (GRCm39) R410W probably damaging Het
Cacna2d3 T C 14: 28,627,222 (GRCm39) *265W probably null Het
Ccdc96 G A 5: 36,642,533 (GRCm39) E180K probably benign Het
Cep164 T C 9: 45,691,088 (GRCm39) K1231E possibly damaging Het
Cnot1 A G 8: 96,499,895 (GRCm39) probably benign Het
Cpne2 T C 8: 95,281,583 (GRCm39) V206A probably benign Het
Dchs1 A G 7: 105,411,085 (GRCm39) Y1647H probably damaging Het
Dnaaf5 A G 5: 139,156,088 (GRCm39) T590A probably benign Het
Eif4g1 A T 16: 20,504,270 (GRCm39) I1068F probably damaging Het
Ephb4 A T 5: 137,364,849 (GRCm39) K639N probably damaging Het
Gcc2 A G 10: 58,105,871 (GRCm39) probably null Het
Gm35315 A C 5: 110,227,129 (GRCm39) Y103* probably null Het
Hsd17b4 A G 18: 50,312,169 (GRCm39) K578R possibly damaging Het
Ice2 T C 9: 69,335,734 (GRCm39) S906P probably benign Het
Irx4 G T 13: 73,416,545 (GRCm39) A314S probably benign Het
Lama5 G A 2: 179,833,455 (GRCm39) P1519L probably damaging Het
Lrp1b A T 2: 40,615,454 (GRCm39) W3650R probably benign Het
Mcoln3 C T 3: 145,833,942 (GRCm39) H161Y probably benign Het
Mphosph10 A T 7: 64,035,567 (GRCm39) M368K probably damaging Het
Msh2 A C 17: 88,020,094 (GRCm39) K567Q possibly damaging Het
N4bp3 T C 11: 51,534,776 (GRCm39) E429G possibly damaging Het
Nrxn3 G A 12: 89,159,924 (GRCm39) A17T probably damaging Het
Or2aj6 T C 16: 19,443,773 (GRCm39) T26A probably benign Het
Or5b106 T A 19: 13,123,552 (GRCm39) Y157F probably benign Het
P4ha2 G T 11: 54,008,474 (GRCm39) R227L probably benign Het
Pfkfb4 G A 9: 108,838,630 (GRCm39) probably null Het
Ror1 A G 4: 100,299,303 (GRCm39) N892S probably benign Het
Scn9a G T 2: 66,313,846 (GRCm39) D1957E probably benign Het
Sec24a A T 11: 51,604,476 (GRCm39) Y713* probably null Het
Serpinb1b T A 13: 33,271,438 (GRCm39) F70I probably damaging Het
Setdb1 T C 3: 95,231,460 (GRCm39) Y1284C probably damaging Het
Suco A T 1: 161,655,809 (GRCm39) M1030K possibly damaging Het
Syne1 A T 10: 5,165,667 (GRCm39) probably null Het
Other mutations in Akr1b1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02806:Akr1b1 APN 6 34,281,254 (GRCm39) missense probably damaging 1.00
R0567:Akr1b1 UTSW 6 34,281,280 (GRCm39) splice site probably null
R0611:Akr1b1 UTSW 6 34,286,577 (GRCm39) missense probably benign 0.02
R1564:Akr1b1 UTSW 6 34,283,470 (GRCm39) splice site probably null
R2445:Akr1b1 UTSW 6 34,287,869 (GRCm39) missense probably benign 0.26
R2507:Akr1b1 UTSW 6 34,286,999 (GRCm39) missense probably damaging 1.00
R4323:Akr1b1 UTSW 6 34,287,862 (GRCm39) missense probably benign 0.00
R4373:Akr1b1 UTSW 6 34,281,202 (GRCm39) utr 3 prime probably benign
R4606:Akr1b1 UTSW 6 34,283,599 (GRCm39) unclassified probably benign
R5513:Akr1b1 UTSW 6 34,293,581 (GRCm39) intron probably benign
R6031:Akr1b1 UTSW 6 34,289,609 (GRCm39) missense probably benign 0.07
R6031:Akr1b1 UTSW 6 34,289,609 (GRCm39) missense probably benign 0.07
R6560:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R6561:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R6654:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R6655:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R6657:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R6658:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R6662:Akr1b1 UTSW 6 34,286,939 (GRCm39) missense possibly damaging 0.56
R8209:Akr1b1 UTSW 6 34,288,867 (GRCm39) missense probably damaging 0.99
R8226:Akr1b1 UTSW 6 34,288,867 (GRCm39) missense probably damaging 0.99
R8921:Akr1b1 UTSW 6 34,289,639 (GRCm39) missense probably benign 0.00
R9802:Akr1b1 UTSW 6 34,283,508 (GRCm39) missense probably benign 0.25
Predicted Primers PCR Primer
(F):5'- TGCAGAAGAATATCCATCTTGTTCC -3'
(R):5'- GCCATCAACTGGGAAATGTGG -3'

Sequencing Primer
(F):5'- TTCCTAGGAACATCAACCTCCCAG -3'
(R):5'- GGGGGAGTTGTTACAGCTTATC -3'
Posted On 2018-06-22