Incidental Mutation 'R6633:Rag1'
ID525274
Institutional Source Beutler Lab
Gene Symbol Rag1
Ensembl Gene ENSMUSG00000061311
Gene Namerecombination activating gene 1
SynonymsRag-1
MMRRC Submission
Accession Numbers

MGI:97848

Is this an essential gene? Possibly non essential (E-score: 0.438) question?
Stock #R6633 (G1)
Quality Score225.009
Status Validated
Chromosome2
Chromosomal Location101638282-101649501 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 101642710 bp
ZygosityHeterozygous
Amino Acid Change Arginine to Tryptophan at position 696 (R696W)
Ref Sequence ENSEMBL: ENSMUSP00000077584 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000078494] [ENSMUST00000160037] [ENSMUST00000160722]
PDB Structure
RAG1 DIMERIZATION DOMAIN [X-RAY DIFFRACTION]
Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION]
Crystal structure of the RAG1 nonamer-binding domain with DNA [X-RAY DIFFRACTION]
Crystal structure of the core RAG1/2 recombinase [X-RAY DIFFRACTION]
Predicted Effect probably damaging
Transcript: ENSMUST00000078494
AA Change: R696W

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000077584
Gene: ENSMUSG00000061311
AA Change: R696W

DomainStartEndE-ValueType
Pfam:RAG1_imp_bd 11 288 5.7e-120 PFAM
RING 290 328 1.39e-3 SMART
ZnF_C2H2 353 376 2.61e1 SMART
PDB:3GNB|A 389 464 3e-44 PDB
ZnF_C2H2 725 750 7e1 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000160037
Predicted Effect probably benign
Transcript: ENSMUST00000160722
Predicted Effect noncoding transcript
Transcript: ENSMUST00000177171
Meta Mutation Damage Score 0.0244 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in activation of immunoglobulin V-D-J recombination. The encoded protein is involved in recognition of the DNA substrate, but stable binding and cleavage activity also requires RAG2. Defects in this gene can be the cause of several diseases. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygotes for targeted null mutations exhibit arrested development of T and B cell maturation at the CD4-8- thymocyte or B220+/CD43+pro-B cell stage due to inability to undergo V(D)J recombination. [provided by MGI curators]
Allele List at MGI

All alleles(13) : Targeted(10) Chemically induced(3)

Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf C A 11: 84,511,482 probably null Het
Acot7 C T 4: 152,178,259 P30L probably benign Het
Adam24 T G 8: 40,680,487 D331E probably benign Het
Adamdec1 T C 14: 68,573,152 D185G probably benign Het
Adgrg7 T C 16: 56,730,286 I688V probably benign Het
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Agtr1a A G 13: 30,381,467 I172V probably benign Het
Anapc4 C T 5: 52,865,946 H710Y possibly damaging Het
Arf1 T C 11: 59,212,544 N179S probably benign Het
Arhgef40 C T 14: 51,997,431 P1064S probably damaging Het
Btnl1 A G 17: 34,385,331 N362S possibly damaging Het
Ccdc80 T C 16: 45,094,908 F9S possibly damaging Het
Ccdc96 G A 5: 36,485,189 E180K probably benign Het
Cdh2 A T 18: 16,640,548 N241K probably benign Het
Cdk8 C A 5: 146,298,846 S261* probably null Het
Csf2rb2 T C 15: 78,288,952 E236G probably benign Het
Dgcr8 A T 16: 18,284,182 S79T possibly damaging Het
Dnah5 A T 15: 28,293,787 Y1346F probably benign Het
Dock6 A G 9: 21,820,331 V1194A probably benign Het
Dock6 A G 9: 21,821,503 S1129P probably damaging Het
Ephb2 C G 4: 136,683,996 S451T probably benign Het
Esco1 T A 18: 10,595,738 probably benign Het
Fcer1a C G 1: 173,226,726 probably null Het
Gbx2 TCCCCC TCCCCCC 1: 89,928,720 probably null Het
Gm44511 T A 6: 128,826,242 D2V probably damaging Het
H2-Q2 A G 17: 35,342,387 T19A probably damaging Het
Herc1 G T 9: 66,439,252 E1967* probably null Het
Hic1 G T 11: 75,169,498 H8N unknown Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Jarid2 C A 13: 44,884,877 H84N probably damaging Het
Klk1b27 A T 7: 44,055,810 I134F probably damaging Het
Kprp T C 3: 92,825,293 Y150C probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp10 T C 14: 54,469,074 V489A probably benign Het
Mrgpra6 A G 7: 47,188,745 I235T possibly damaging Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Olfr1259 T C 2: 89,943,366 I250V probably benign Het
Plcl2 A G 17: 50,640,140 I1016V probably benign Het
Plekhb1 A G 7: 100,645,639 Y122H probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Rusc2 T C 4: 43,414,852 F53L probably damaging Het
Tango6 T C 8: 106,718,005 V514A probably benign Het
Tex30 A C 1: 44,087,924 H64Q probably benign Het
Tmbim7 A G 5: 3,657,659 probably null Het
Tmem5 G A 10: 122,097,053 R7W probably damaging Het
Tpcn1 A G 5: 120,544,464 M493T probably benign Het
Tpx2 T G 2: 152,867,354 F35V probably damaging Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Wnt2b T C 3: 104,951,056 Y299C probably damaging Het
Other mutations in Rag1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00940:Rag1 APN 2 101642388 missense probably damaging 1.00
IGL01125:Rag1 APN 2 101642001 missense probably damaging 0.99
IGL01836:Rag1 APN 2 101641894 missense probably damaging 1.00
IGL02216:Rag1 APN 2 101643381 missense possibly damaging 0.91
IGL02271:Rag1 APN 2 101643388 missense probably damaging 0.99
IGL02293:Rag1 APN 2 101643046 missense probably benign 0.39
IGL02601:Rag1 APN 2 101642673 missense probably damaging 1.00
busted UTSW 2 101641947 missense probably damaging 1.00
defective UTSW 2 101642710 missense probably damaging 1.00
dysfunctional UTSW 2 101644284 missense probably damaging 1.00
huckle UTSW 2 101641223 intron probably benign
maladaptive UTSW 2 101645647 intron probably benign
R0658:Rag1 UTSW 2 101642683 missense probably damaging 0.99
R1126:Rag1 UTSW 2 101642689 missense probably damaging 1.00
R1177:Rag1 UTSW 2 101642278 missense probably benign 0.10
R1319:Rag1 UTSW 2 101643192 missense probably damaging 1.00
R1513:Rag1 UTSW 2 101642991 missense possibly damaging 0.95
R1859:Rag1 UTSW 2 101644062 missense probably benign 0.03
R2218:Rag1 UTSW 2 101644146 missense probably benign
R3932:Rag1 UTSW 2 101643039 missense probably damaging 1.00
R4127:Rag1 UTSW 2 101642071 missense probably damaging 1.00
R4365:Rag1 UTSW 2 101642943 missense probably damaging 1.00
R4620:Rag1 UTSW 2 101643680 missense probably damaging 1.00
R4815:Rag1 UTSW 2 101643516 missense probably damaging 0.99
R5070:Rag1 UTSW 2 101642311 missense probably damaging 1.00
R5209:Rag1 UTSW 2 101644215 missense probably benign 0.01
R5239:Rag1 UTSW 2 101642955 missense possibly damaging 0.91
R5390:Rag1 UTSW 2 101642734 missense probably benign
R5607:Rag1 UTSW 2 101643792 missense probably damaging 1.00
R6259:Rag1 UTSW 2 101644452 missense possibly damaging 0.83
R6412:Rag1 UTSW 2 101642520 missense probably damaging 0.99
R6679:Rag1 UTSW 2 101644284 missense probably damaging 1.00
R6723:Rag1 UTSW 2 101643645 missense probably damaging 0.99
R6853:Rag1 UTSW 2 101642221 missense probably damaging 0.99
R6867:Rag1 UTSW 2 101641947 missense probably damaging 1.00
R6974:Rag1 UTSW 2 101641792 missense probably damaging 0.99
R7071:Rag1 UTSW 2 101643462 missense probably damaging 0.99
R7124:Rag1 UTSW 2 101643783 missense probably damaging 0.99
R7248:Rag1 UTSW 2 101641778 missense probably damaging 0.99
R7256:Rag1 UTSW 2 101642070 missense probably damaging 1.00
X0018:Rag1 UTSW 2 101643597 missense probably damaging 1.00
X0018:Rag1 UTSW 2 101644547 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- CTTCCACGGACTCATGATACGG -3'
(R):5'- GTGAAGGTGTTTGAGGAACCC -3'

Sequencing Primer
(F):5'- ACTCATGATACGGATTGGACC -3'
(R):5'- TGTTTGAGGAACCCAAGCC -3'
Posted On2018-06-22