Incidental Mutation 'R6633:Cdk8'
ID525294
Institutional Source Beutler Lab
Gene Symbol Cdk8
Ensembl Gene ENSMUSG00000029635
Gene Namecyclin-dependent kinase 8
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6633 (G1)
Quality Score225.009
Status Validated
Chromosome5
Chromosomal Location146231230-146302874 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to A at 146298846 bp
ZygosityHeterozygous
Amino Acid Change Serine to Stop codon at position 261 (S261*)
Ref Sequence ENSEMBL: ENSMUSP00000125668 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000031640] [ENSMUST00000161181] [ENSMUST00000162494]
Predicted Effect probably null
Transcript: ENSMUST00000031640
AA Change: S326*
SMART Domains Protein: ENSMUSP00000031640
Gene: ENSMUSG00000029635
AA Change: S326*

DomainStartEndE-ValueType
S_TKc 21 335 1.89e-83 SMART
low complexity region 372 391 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000159615
Predicted Effect noncoding transcript
Transcript: ENSMUST00000160924
Predicted Effect probably null
Transcript: ENSMUST00000161181
AA Change: S261*
SMART Domains Protein: ENSMUSP00000125668
Gene: ENSMUSG00000029635
AA Change: S261*

DomainStartEndE-ValueType
Pfam:Pkinase_Tyr 1 179 6e-16 PFAM
Pfam:Pkinase 1 270 1.6e-44 PFAM
low complexity region 307 326 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000162494
SMART Domains Protein: ENSMUSP00000125516
Gene: ENSMUSG00000029635

DomainStartEndE-ValueType
Pfam:Pkinase 22 153 5.9e-25 PFAM
Pfam:Pkinase_Tyr 22 156 1.5e-15 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the cyclin-dependent protein kinase (CDK) family. CDK family members are known to be important regulators of cell cycle progression. This kinase and its regulatory subunit, cyclin C, are components of the Mediator transcriptional regulatory complex, involved in both transcriptional activation and repression by phosphorylation of the carboxy-terminal domain of the largest subunit of RNA polymerase II. This kinase regulates transcription by targeting the cyclin-dependent kinase 7 subunits of the general transcription initiation factor IIH, thus providing a link between the Mediator complex and the basal transcription machinery. Multiple pseudogenes of this gene have been identified. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Oct 2016]
PHENOTYPE: Mice homozygous for a gene-trapped allele die prior to implantation exhibiting fragmented blastomeres and failure to undergo compaction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf C A 11: 84,511,482 probably null Het
Acot7 C T 4: 152,178,259 P30L probably benign Het
Adam24 T G 8: 40,680,487 D331E probably benign Het
Adamdec1 T C 14: 68,573,152 D185G probably benign Het
Adgrg7 T C 16: 56,730,286 I688V probably benign Het
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Agtr1a A G 13: 30,381,467 I172V probably benign Het
Anapc4 C T 5: 52,865,946 H710Y possibly damaging Het
Arf1 T C 11: 59,212,544 N179S probably benign Het
Arhgef40 C T 14: 51,997,431 P1064S probably damaging Het
Btnl1 A G 17: 34,385,331 N362S possibly damaging Het
Ccdc80 T C 16: 45,094,908 F9S possibly damaging Het
Ccdc96 G A 5: 36,485,189 E180K probably benign Het
Cdh2 A T 18: 16,640,548 N241K probably benign Het
Csf2rb2 T C 15: 78,288,952 E236G probably benign Het
Dgcr8 A T 16: 18,284,182 S79T possibly damaging Het
Dnah5 A T 15: 28,293,787 Y1346F probably benign Het
Dock6 A G 9: 21,820,331 V1194A probably benign Het
Dock6 A G 9: 21,821,503 S1129P probably damaging Het
Ephb2 C G 4: 136,683,996 S451T probably benign Het
Esco1 T A 18: 10,595,738 probably benign Het
Fcer1a C G 1: 173,226,726 probably null Het
Gbx2 TCCCCC TCCCCCC 1: 89,928,720 probably null Het
Gm44511 T A 6: 128,826,242 D2V probably damaging Het
H2-Q2 A G 17: 35,342,387 T19A probably damaging Het
Herc1 G T 9: 66,439,252 E1967* probably null Het
Hic1 G T 11: 75,169,498 H8N unknown Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Jarid2 C A 13: 44,884,877 H84N probably damaging Het
Klk1b27 A T 7: 44,055,810 I134F probably damaging Het
Kprp T C 3: 92,825,293 Y150C probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp10 T C 14: 54,469,074 V489A probably benign Het
Mrgpra6 A G 7: 47,188,745 I235T possibly damaging Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Olfr1259 T C 2: 89,943,366 I250V probably benign Het
Plcl2 A G 17: 50,640,140 I1016V probably benign Het
Plekhb1 A G 7: 100,645,639 Y122H probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Rag1 T A 2: 101,642,710 R696W probably damaging Het
Rusc2 T C 4: 43,414,852 F53L probably damaging Het
Tango6 T C 8: 106,718,005 V514A probably benign Het
Tex30 A C 1: 44,087,924 H64Q probably benign Het
Tmbim7 A G 5: 3,657,659 probably null Het
Tmem5 G A 10: 122,097,053 R7W probably damaging Het
Tpcn1 A G 5: 120,544,464 M493T probably benign Het
Tpx2 T G 2: 152,867,354 F35V probably damaging Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Wnt2b T C 3: 104,951,056 Y299C probably damaging Het
Other mutations in Cdk8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01476:Cdk8 APN 5 146295163 unclassified probably null
R0506:Cdk8 UTSW 5 146298872 missense probably damaging 1.00
R1132:Cdk8 UTSW 5 146299815 missense probably benign 0.09
R1513:Cdk8 UTSW 5 146296378 missense possibly damaging 0.93
R2231:Cdk8 UTSW 5 146231604 start gained probably benign
R3692:Cdk8 UTSW 5 146283668 nonsense probably null
R4157:Cdk8 UTSW 5 146299449 intron probably benign
R4760:Cdk8 UTSW 5 146292666 missense probably benign 0.15
R4804:Cdk8 UTSW 5 146296399 missense probably damaging 1.00
R5119:Cdk8 UTSW 5 146283627 critical splice acceptor site probably null
R6755:Cdk8 UTSW 5 146268316 missense probably damaging 1.00
R7442:Cdk8 UTSW 5 146292769 critical splice donor site probably null
Predicted Primers PCR Primer
(F):5'- TCTGGATGTGACAGGGATGAGC -3'
(R):5'- GAGCAGAGACGCTCAGTTTC -3'

Sequencing Primer
(F):5'- GTGTAGCTACAATACTCACACTTAGG -3'
(R):5'- AGCAGAGACGCTCAGTTTCTTCAG -3'
Posted On2018-06-22