Incidental Mutation 'R6633:Adam24'
ID525304
Institutional Source Beutler Lab
Gene Symbol Adam24
Ensembl Gene ENSMUSG00000046723
Gene Namea disintegrin and metallopeptidase domain 24 (testase 1)
SynonymsDtgn5
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.084) question?
Stock #R6633 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location40675077-40682199 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to G at 40680487 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glutamic Acid at position 331 (D331E)
Ref Sequence ENSEMBL: ENSMUSP00000050727 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000051614]
Predicted Effect probably benign
Transcript: ENSMUST00000051614
AA Change: D331E

PolyPhen 2 Score 0.123 (Sensitivity: 0.93; Specificity: 0.86)
SMART Domains Protein: ENSMUSP00000050727
Gene: ENSMUSG00000046723
AA Change: D331E

DomainStartEndE-ValueType
signal peptide 1 34 N/A INTRINSIC
Pfam:Pep_M12B_propep 39 160 3.3e-14 PFAM
Pfam:Reprolysin_2 193 389 6.3e-13 PFAM
Pfam:Reprolysin 208 398 7.8e-43 PFAM
Pfam:Reprolysin_5 209 382 3e-17 PFAM
Pfam:Reprolysin_4 209 392 4.9e-13 PFAM
Pfam:Reprolysin_3 232 353 9.9e-16 PFAM
DISIN 415 491 7.13e-39 SMART
ACR 492 628 7.74e-69 SMART
transmembrane domain 698 720 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000210267
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional metalloprotease enzyme. Male mice lacking the encoded protein exhibit reduced fertility due to the higher incidence of polyspermic embryos. This gene is located adjacent to other ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
PHENOTYPE: Males homozygous for a targeted null mutation are subfertile and produce an increased number of polyspermic embryos at the pronuclear stage. Female homozygotes show normal fertility. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf C A 11: 84,511,482 probably null Het
Acot7 C T 4: 152,178,259 P30L probably benign Het
Adamdec1 T C 14: 68,573,152 D185G probably benign Het
Adgrg7 T C 16: 56,730,286 I688V probably benign Het
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Agtr1a A G 13: 30,381,467 I172V probably benign Het
Anapc4 C T 5: 52,865,946 H710Y possibly damaging Het
Arf1 T C 11: 59,212,544 N179S probably benign Het
Arhgef40 C T 14: 51,997,431 P1064S probably damaging Het
Btnl1 A G 17: 34,385,331 N362S possibly damaging Het
Ccdc80 T C 16: 45,094,908 F9S possibly damaging Het
Ccdc96 G A 5: 36,485,189 E180K probably benign Het
Cdh2 A T 18: 16,640,548 N241K probably benign Het
Cdk8 C A 5: 146,298,846 S261* probably null Het
Csf2rb2 T C 15: 78,288,952 E236G probably benign Het
Dgcr8 A T 16: 18,284,182 S79T possibly damaging Het
Dnah5 A T 15: 28,293,787 Y1346F probably benign Het
Dock6 A G 9: 21,820,331 V1194A probably benign Het
Dock6 A G 9: 21,821,503 S1129P probably damaging Het
Ephb2 C G 4: 136,683,996 S451T probably benign Het
Esco1 T A 18: 10,595,738 probably benign Het
Fcer1a C G 1: 173,226,726 probably null Het
Gbx2 TCCCCC TCCCCCC 1: 89,928,720 probably null Het
Gm44511 T A 6: 128,826,242 D2V probably damaging Het
H2-Q2 A G 17: 35,342,387 T19A probably damaging Het
Herc1 G T 9: 66,439,252 E1967* probably null Het
Hic1 G T 11: 75,169,498 H8N unknown Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Jarid2 C A 13: 44,884,877 H84N probably damaging Het
Klk1b27 A T 7: 44,055,810 I134F probably damaging Het
Kprp T C 3: 92,825,293 Y150C probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp10 T C 14: 54,469,074 V489A probably benign Het
Mrgpra6 A G 7: 47,188,745 I235T possibly damaging Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Olfr1259 T C 2: 89,943,366 I250V probably benign Het
Plcl2 A G 17: 50,640,140 I1016V probably benign Het
Plekhb1 A G 7: 100,645,639 Y122H probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Rag1 T A 2: 101,642,710 R696W probably damaging Het
Rusc2 T C 4: 43,414,852 F53L probably damaging Het
Tango6 T C 8: 106,718,005 V514A probably benign Het
Tex30 A C 1: 44,087,924 H64Q probably benign Het
Tmbim7 A G 5: 3,657,659 probably null Het
Tmem5 G A 10: 122,097,053 R7W probably damaging Het
Tpcn1 A G 5: 120,544,464 M493T probably benign Het
Tpx2 T G 2: 152,867,354 F35V probably damaging Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Wnt2b T C 3: 104,951,056 Y299C probably damaging Het
Other mutations in Adam24
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02479:Adam24 APN 8 40679532 missense probably benign 0.41
IGL02517:Adam24 APN 8 40680179 missense probably damaging 1.00
R0195:Adam24 UTSW 8 40681766 missense probably benign 0.00
R1067:Adam24 UTSW 8 40680754 nonsense probably null
R1180:Adam24 UTSW 8 40681428 missense probably damaging 1.00
R1438:Adam24 UTSW 8 40681392 missense probably benign 0.19
R1741:Adam24 UTSW 8 40679603 missense probably benign 0.00
R1779:Adam24 UTSW 8 40680965 missense possibly damaging 0.83
R1940:Adam24 UTSW 8 40681361 nonsense probably null
R2228:Adam24 UTSW 8 40680365 missense probably benign 0.00
R2229:Adam24 UTSW 8 40680365 missense probably benign 0.00
R2265:Adam24 UTSW 8 40680071 missense possibly damaging 0.95
R2359:Adam24 UTSW 8 40680945 missense possibly damaging 0.91
R3551:Adam24 UTSW 8 40679593 missense probably benign 0.03
R3837:Adam24 UTSW 8 40680545 missense probably benign
R4834:Adam24 UTSW 8 40679699 missense probably damaging 1.00
R5121:Adam24 UTSW 8 40679511 missense probably damaging 1.00
R5410:Adam24 UTSW 8 40681064 missense probably benign 0.01
R5787:Adam24 UTSW 8 40680902 missense possibly damaging 0.87
R5900:Adam24 UTSW 8 40681032 missense probably benign 0.00
R6600:Adam24 UTSW 8 40680548 missense probably damaging 1.00
R6672:Adam24 UTSW 8 40681533 missense probably benign 0.01
R6904:Adam24 UTSW 8 40681503 missense probably damaging 1.00
R7178:Adam24 UTSW 8 40680000 nonsense probably null
R7542:Adam24 UTSW 8 40680809 missense not run
X0010:Adam24 UTSW 8 40680015 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- TTGCCAGCATTTTGTACGTG -3'
(R):5'- TCCCACAGACCTTCAATTGG -3'

Sequencing Primer
(F):5'- CCAGCATTTTGTACGTGGAAGG -3'
(R):5'- AATATCAGAAGGTCTGGGCTCTC -3'
Posted On2018-06-22