Incidental Mutation 'R6633:Tango6'
ID525306
Institutional Source Beutler Lab
Gene Symbol Tango6
Ensembl Gene ENSMUSG00000041949
Gene Nametransport and golgi organization 6
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6633 (G1)
Quality Score225.009
Status Validated
Chromosome8
Chromosomal Location106683068-106851439 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 106718005 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 514 (V514A)
Ref Sequence ENSEMBL: ENSMUSP00000043953 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000048359]
Predicted Effect probably benign
Transcript: ENSMUST00000048359
AA Change: V514A

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000043953
Gene: ENSMUSG00000041949
AA Change: V514A

DomainStartEndE-ValueType
low complexity region 2 13 N/A INTRINSIC
low complexity region 20 41 N/A INTRINSIC
low complexity region 102 115 N/A INTRINSIC
low complexity region 246 259 N/A INTRINSIC
low complexity region 334 350 N/A INTRINSIC
low complexity region 472 486 N/A INTRINSIC
Pfam:RTP1_C1 824 935 1.6e-35 PFAM
low complexity region 998 1013 N/A INTRINSIC
Pfam:RTP1_C2 1026 1059 7.5e-14 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000212764
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (50/50)
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf C A 11: 84,511,482 probably null Het
Acot7 C T 4: 152,178,259 P30L probably benign Het
Adam24 T G 8: 40,680,487 D331E probably benign Het
Adamdec1 T C 14: 68,573,152 D185G probably benign Het
Adgrg7 T C 16: 56,730,286 I688V probably benign Het
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Agtr1a A G 13: 30,381,467 I172V probably benign Het
Anapc4 C T 5: 52,865,946 H710Y possibly damaging Het
Arf1 T C 11: 59,212,544 N179S probably benign Het
Arhgef40 C T 14: 51,997,431 P1064S probably damaging Het
Btnl1 A G 17: 34,385,331 N362S possibly damaging Het
Ccdc80 T C 16: 45,094,908 F9S possibly damaging Het
Ccdc96 G A 5: 36,485,189 E180K probably benign Het
Cdh2 A T 18: 16,640,548 N241K probably benign Het
Cdk8 C A 5: 146,298,846 S261* probably null Het
Csf2rb2 T C 15: 78,288,952 E236G probably benign Het
Dgcr8 A T 16: 18,284,182 S79T possibly damaging Het
Dnah5 A T 15: 28,293,787 Y1346F probably benign Het
Dock6 A G 9: 21,820,331 V1194A probably benign Het
Dock6 A G 9: 21,821,503 S1129P probably damaging Het
Ephb2 C G 4: 136,683,996 S451T probably benign Het
Esco1 T A 18: 10,595,738 probably benign Het
Fcer1a C G 1: 173,226,726 probably null Het
Gbx2 TCCCCC TCCCCCC 1: 89,928,720 probably null Het
Gm44511 T A 6: 128,826,242 D2V probably damaging Het
H2-Q2 A G 17: 35,342,387 T19A probably damaging Het
Herc1 G T 9: 66,439,252 E1967* probably null Het
Hic1 G T 11: 75,169,498 H8N unknown Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Jarid2 C A 13: 44,884,877 H84N probably damaging Het
Klk1b27 A T 7: 44,055,810 I134F probably damaging Het
Kprp T C 3: 92,825,293 Y150C probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp10 T C 14: 54,469,074 V489A probably benign Het
Mrgpra6 A G 7: 47,188,745 I235T possibly damaging Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Olfr1259 T C 2: 89,943,366 I250V probably benign Het
Plcl2 A G 17: 50,640,140 I1016V probably benign Het
Plekhb1 A G 7: 100,645,639 Y122H probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Ppp6r2 G A 15: 89,253,255 probably null Het
Rag1 T A 2: 101,642,710 R696W probably damaging Het
Rusc2 T C 4: 43,414,852 F53L probably damaging Het
Tex30 A C 1: 44,087,924 H64Q probably benign Het
Tmbim7 A G 5: 3,657,659 probably null Het
Tmem5 G A 10: 122,097,053 R7W probably damaging Het
Tpcn1 A G 5: 120,544,464 M493T probably benign Het
Tpx2 T G 2: 152,867,354 F35V probably damaging Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Wnt2b T C 3: 104,951,056 Y299C probably damaging Het
Other mutations in Tango6
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00905:Tango6 APN 8 106742472 critical splice donor site probably null
IGL00925:Tango6 APN 8 106695445 splice site probably benign
IGL00965:Tango6 APN 8 106742010 splice site probably benign
IGL01412:Tango6 APN 8 106818499 missense probably benign 0.02
IGL02888:Tango6 APN 8 106720665 missense probably damaging 1.00
IGL02892:Tango6 APN 8 106742010 splice site probably benign
R0241:Tango6 UTSW 8 106747361 splice site probably benign
R0494:Tango6 UTSW 8 106735682 splice site probably benign
R1127:Tango6 UTSW 8 106688895 missense probably benign 0.00
R1440:Tango6 UTSW 8 106689039 missense probably damaging 1.00
R1547:Tango6 UTSW 8 106781786 missense probably damaging 0.98
R1921:Tango6 UTSW 8 106688794 missense probably benign 0.06
R2255:Tango6 UTSW 8 106689294 critical splice donor site probably null
R2761:Tango6 UTSW 8 106699032 missense possibly damaging 0.93
R4211:Tango6 UTSW 8 106689224 missense probably benign 0.02
R4463:Tango6 UTSW 8 106689074 missense probably benign 0.29
R4696:Tango6 UTSW 8 106700231 missense possibly damaging 0.73
R4867:Tango6 UTSW 8 106818526 missense probably damaging 1.00
R4946:Tango6 UTSW 8 106718090 nonsense probably null
R5459:Tango6 UTSW 8 106850289 missense probably damaging 1.00
R5522:Tango6 UTSW 8 106695598 critical splice donor site probably null
R5795:Tango6 UTSW 8 106718077 missense probably damaging 1.00
R5878:Tango6 UTSW 8 106689168 missense possibly damaging 0.77
R6318:Tango6 UTSW 8 106818497 missense probably benign
R6335:Tango6 UTSW 8 106692676 missense possibly damaging 0.94
R6664:Tango6 UTSW 8 106742114 missense probably damaging 1.00
R6838:Tango6 UTSW 8 106742074 missense probably benign 0.00
R6866:Tango6 UTSW 8 106742472 critical splice donor site probably null
R7046:Tango6 UTSW 8 106807116 missense possibly damaging 0.86
R7130:Tango6 UTSW 8 106807101 missense probably damaging 1.00
R7199:Tango6 UTSW 8 106689159 missense probably benign 0.01
R7418:Tango6 UTSW 8 106688834 missense probably benign 0.26
R7480:Tango6 UTSW 8 106696727 missense possibly damaging 0.63
Predicted Primers PCR Primer
(F):5'- TGTAAGATGCATGCTTCCCTGTC -3'
(R):5'- TGACTCACAGAACAGTGTCG -3'

Sequencing Primer
(F):5'- TTCCCTGTCGAGTGTCAGCAG -3'
(R):5'- GTCGTATAAAAACTTCTGTCAGGCG -3'
Posted On2018-06-22