Incidental Mutation 'R6633:Ppp6r2'
ID525344
Institutional Source Beutler Lab
Gene Symbol Ppp6r2
Ensembl Gene ENSMUSG00000036561
Gene Nameprotein phosphatase 6, regulatory subunit 2
SynonymsPp6r2, Saps2, 1110033O10Rik, 8430411H09Rik, B230107H12Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.159) question?
Stock #R6633 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location89211553-89287010 bp(+) (GRCm38)
Type of Mutationsplice site (5 bp from exon)
DNA Base Change (assembly) G to A at 89253255 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000154297 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000088788] [ENSMUST00000226221] [ENSMUST00000226221] [ENSMUST00000227951] [ENSMUST00000228284]
Predicted Effect probably damaging
Transcript: ENSMUST00000088788
AA Change: R74Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000086167
Gene: ENSMUSG00000036561
AA Change: R74Q

DomainStartEndE-ValueType
Pfam:SAPS 128 365 1.7e-73 PFAM
Pfam:SAPS 361 534 2.4e-47 PFAM
low complexity region 606 618 N/A INTRINSIC
low complexity region 788 802 N/A INTRINSIC
low complexity region 867 900 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000226221
Predicted Effect probably null
Transcript: ENSMUST00000226221
Predicted Effect noncoding transcript
Transcript: ENSMUST00000226779
Predicted Effect probably benign
Transcript: ENSMUST00000227951
Predicted Effect probably damaging
Transcript: ENSMUST00000228284
AA Change: R74Q

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
Meta Mutation Damage Score 0.568 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 100% (50/50)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] Protein phosphatase regulatory subunits, such as SAPS2, modulate the activity of protein phosphatase catalytic subunits by restricting substrate specificity, recruiting substrates, and determining the intracellular localization of the holoenzyme. SAPS2 is a regulatory subunit for the protein phosphatase-6 catalytic subunit (PPP6C; MIM 612725) (Stefansson and Brautigan, 2006 [PubMed 16769727]).[supplied by OMIM, Nov 2010]
Allele List at MGI
Other mutations in this stock
Total: 51 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Aatf C A 11: 84,511,482 probably null Het
Acot7 C T 4: 152,178,259 P30L probably benign Het
Adam24 T G 8: 40,680,487 D331E probably benign Het
Adamdec1 T C 14: 68,573,152 D185G probably benign Het
Adgrg7 T C 16: 56,730,286 I688V probably benign Het
Adgrv1 A T 13: 81,568,643 F779I probably damaging Het
Agtr1a A G 13: 30,381,467 I172V probably benign Het
Anapc4 C T 5: 52,865,946 H710Y possibly damaging Het
Arf1 T C 11: 59,212,544 N179S probably benign Het
Arhgef40 C T 14: 51,997,431 P1064S probably damaging Het
Btnl1 A G 17: 34,385,331 N362S possibly damaging Het
Ccdc80 T C 16: 45,094,908 F9S possibly damaging Het
Ccdc96 G A 5: 36,485,189 E180K probably benign Het
Cdh2 A T 18: 16,640,548 N241K probably benign Het
Cdk8 C A 5: 146,298,846 S261* probably null Het
Csf2rb2 T C 15: 78,288,952 E236G probably benign Het
Dgcr8 A T 16: 18,284,182 S79T possibly damaging Het
Dnah5 A T 15: 28,293,787 Y1346F probably benign Het
Dock6 A G 9: 21,820,331 V1194A probably benign Het
Dock6 A G 9: 21,821,503 S1129P probably damaging Het
Ephb2 C G 4: 136,683,996 S451T probably benign Het
Esco1 T A 18: 10,595,738 probably benign Het
Fcer1a C G 1: 173,226,726 probably null Het
Gbx2 TCCCCC TCCCCCC 1: 89,928,720 probably null Het
Gm44511 T A 6: 128,826,242 D2V probably damaging Het
H2-Q2 A G 17: 35,342,387 T19A probably damaging Het
Herc1 G T 9: 66,439,252 E1967* probably null Het
Hic1 G T 11: 75,169,498 H8N unknown Het
Irx4 G T 13: 73,268,426 A314S probably benign Het
Jarid2 C A 13: 44,884,877 H84N probably damaging Het
Klk1b27 A T 7: 44,055,810 I134F probably damaging Het
Kprp T C 3: 92,825,293 Y150C probably damaging Het
Lama5 G A 2: 180,191,662 P1519L probably damaging Het
Lrp10 T C 14: 54,469,074 V489A probably benign Het
Mrgpra6 A G 7: 47,188,745 I235T possibly damaging Het
Naip1 A G 13: 100,423,076 M1140T probably benign Het
Naip1 C T 13: 100,423,085 R1137Q probably benign Het
Olfr1259 T C 2: 89,943,366 I250V probably benign Het
Plcl2 A G 17: 50,640,140 I1016V probably benign Het
Plekhb1 A G 7: 100,645,639 Y122H probably damaging Het
Polr2a A G 11: 69,735,513 S1604P possibly damaging Het
Rag1 T A 2: 101,642,710 R696W probably damaging Het
Rusc2 T C 4: 43,414,852 F53L probably damaging Het
Tango6 T C 8: 106,718,005 V514A probably benign Het
Tex30 A C 1: 44,087,924 H64Q probably benign Het
Tmbim7 A G 5: 3,657,659 probably null Het
Tmem5 G A 10: 122,097,053 R7W probably damaging Het
Tpcn1 A G 5: 120,544,464 M493T probably benign Het
Tpx2 T G 2: 152,867,354 F35V probably damaging Het
Vmn1r3 G A 4: 3,184,971 T112I probably benign Het
Wnt2b T C 3: 104,951,056 Y299C probably damaging Het
Other mutations in Ppp6r2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00272:Ppp6r2 APN 15 89285813 missense probably benign 0.44
IGL00480:Ppp6r2 APN 15 89265249 splice site probably benign
IGL01061:Ppp6r2 APN 15 89286015 splice site probably benign
IGL01116:Ppp6r2 APN 15 89281989 missense probably damaging 1.00
IGL01317:Ppp6r2 APN 15 89285928 missense possibly damaging 0.62
IGL01947:Ppp6r2 APN 15 89278726 missense probably damaging 1.00
IGL01969:Ppp6r2 APN 15 89275510 missense probably damaging 0.99
IGL01999:Ppp6r2 APN 15 89269952 missense probably benign 0.09
IGL02634:Ppp6r2 APN 15 89275477 nonsense probably null
IGL02697:Ppp6r2 APN 15 89256755 missense probably benign 0.38
IGL02964:Ppp6r2 APN 15 89259175 missense probably damaging 1.00
IGL03107:Ppp6r2 APN 15 89268545 missense probably damaging 0.98
IGL03195:Ppp6r2 APN 15 89268555 missense possibly damaging 0.50
R0020:Ppp6r2 UTSW 15 89259139 missense probably damaging 1.00
R0020:Ppp6r2 UTSW 15 89259139 missense probably damaging 1.00
R0183:Ppp6r2 UTSW 15 89285787 missense probably damaging 0.99
R0745:Ppp6r2 UTSW 15 89265242 critical splice donor site probably null
R0835:Ppp6r2 UTSW 15 89268582 missense possibly damaging 0.90
R0959:Ppp6r2 UTSW 15 89274176 missense possibly damaging 0.81
R1661:Ppp6r2 UTSW 15 89253051 missense possibly damaging 0.96
R1867:Ppp6r2 UTSW 15 89281938 missense probably benign 0.01
R2081:Ppp6r2 UTSW 15 89282129 missense probably benign 0.01
R2102:Ppp6r2 UTSW 15 89278746 missense probably damaging 1.00
R2291:Ppp6r2 UTSW 15 89275487 missense probably damaging 1.00
R2900:Ppp6r2 UTSW 15 89281995 missense probably damaging 1.00
R3805:Ppp6r2 UTSW 15 89265639 missense probably benign 0.30
R3965:Ppp6r2 UTSW 15 89259114 missense probably benign 0.20
R4374:Ppp6r2 UTSW 15 89265158 missense probably damaging 1.00
R4901:Ppp6r2 UTSW 15 89259069 missense possibly damaging 0.88
R5055:Ppp6r2 UTSW 15 89282949 missense probably benign 0.01
R5668:Ppp6r2 UTSW 15 89280399 missense probably damaging 1.00
R5739:Ppp6r2 UTSW 15 89259073 missense probably benign 0.02
R6026:Ppp6r2 UTSW 15 89282910 missense probably benign 0.02
R6058:Ppp6r2 UTSW 15 89253252 critical splice donor site probably null
R6488:Ppp6r2 UTSW 15 89268538 missense probably benign 0.12
R6631:Ppp6r2 UTSW 15 89253255 splice site probably null
R6744:Ppp6r2 UTSW 15 89256661 critical splice acceptor site probably null
R7149:Ppp6r2 UTSW 15 89262396 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GTTGACAAGCTCCTGGACAAG -3'
(R):5'- CAGCAGTGTCTCTCAATTGC -3'

Sequencing Primer
(F):5'- GGAACATGTGACCCTGCAG -3'
(R):5'- AGTGTCTCTCAATTGCCCCAAC -3'
Posted On2018-06-22