Incidental Mutation 'R6602:Ift88'
ID525384
Institutional Source Beutler Lab
Gene Symbol Ift88
Ensembl Gene ENSMUSG00000040040
Gene Nameintraflagellar transport 88
SynonymsTg737Rpw, IFT88, Tg737, polaris, Oak Ridge polycystic kidneys, TgN737Rpw, orpk, fxo, Ttc10
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6602 (G1)
Quality Score90.0077
Status Validated
Chromosome14
Chromosomal Location57424062-57517936 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 57507259 bp
ZygosityHeterozygous
Amino Acid Change Serine to Glycine at position 745 (S745G)
Ref Sequence ENSEMBL: ENSMUSP00000113768 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000122063]
Predicted Effect probably benign
Transcript: ENSMUST00000122063
AA Change: S745G

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000113768
Gene: ENSMUSG00000040040
AA Change: S745G

DomainStartEndE-ValueType
Blast:TPR 197 229 8e-12 BLAST
TPR 233 266 5.35e-5 SMART
TPR 272 305 5.78e-1 SMART
TPR 485 518 5.73e-5 SMART
TPR 519 552 9.83e-4 SMART
TPR 553 586 5.19e-3 SMART
TPR 587 620 3.87e-2 SMART
Blast:TPR 621 654 7e-12 BLAST
TPR 655 688 3.76e0 SMART
low complexity region 730 748 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000149702
Predicted Effect noncoding transcript
Transcript: ENSMUST00000154492
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the tetratrico peptide repeat (TPR) family. Mutations of a similar gene in mouse can cause polycystic kidney disease. Two transcript variants encoding distinct isoforms have been identified for this gene. [provided by RefSeq, Jul 2008]
PHENOTYPE: Mice homozygous for a null allele display early to mid-gestation lethality, random patterning of the left-right body axis, neural tube defects, pericardial sac expansion, enlarged limb buds, polydactyly, and absent embryonic node cilia. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Msra A T 14: 64,123,339 H184Q probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Ift88
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00742:Ift88 APN 14 57481386 unclassified probably benign
IGL00886:Ift88 APN 14 57478068 missense probably damaging 1.00
IGL00901:Ift88 APN 14 57444445 missense probably damaging 0.99
IGL01148:Ift88 APN 14 57439732 missense probably benign 0.19
IGL01346:Ift88 APN 14 57444405 missense probably damaging 1.00
IGL01474:Ift88 APN 14 57478074 missense probably benign 0.23
IGL02213:Ift88 APN 14 57478045 missense probably damaging 1.00
IGL02391:Ift88 APN 14 57481414 missense possibly damaging 0.64
IGL03087:Ift88 APN 14 57477957 missense probably benign 0.00
R0392:Ift88 UTSW 14 57496160 splice site probably benign
R0608:Ift88 UTSW 14 57496221 missense probably benign
R0718:Ift88 UTSW 14 57517413 missense probably benign 0.02
R1128:Ift88 UTSW 14 57517019 nonsense probably null
R1422:Ift88 UTSW 14 57438301 splice site probably benign
R1422:Ift88 UTSW 14 57472979 missense probably damaging 1.00
R1432:Ift88 UTSW 14 57437279 missense probably benign
R1518:Ift88 UTSW 14 57430628 missense possibly damaging 0.64
R1566:Ift88 UTSW 14 57441011 missense probably benign 0.36
R1819:Ift88 UTSW 14 57455519 missense probably damaging 1.00
R2239:Ift88 UTSW 14 57455504 missense probably damaging 1.00
R2273:Ift88 UTSW 14 57488936 missense possibly damaging 0.90
R2926:Ift88 UTSW 14 57488918 missense probably damaging 1.00
R3033:Ift88 UTSW 14 57478044 missense probably damaging 1.00
R3052:Ift88 UTSW 14 57430568 missense probably damaging 1.00
R3815:Ift88 UTSW 14 57440981 missense possibly damaging 0.88
R4411:Ift88 UTSW 14 57477979 missense probably damaging 0.99
R4703:Ift88 UTSW 14 57480850 unclassified probably benign
R4704:Ift88 UTSW 14 57480850 unclassified probably benign
R4822:Ift88 UTSW 14 57441869 splice site probably null
R5355:Ift88 UTSW 14 57438242 missense probably benign 0.34
R5618:Ift88 UTSW 14 57481508 missense possibly damaging 0.72
R6907:Ift88 UTSW 14 57445610 missense probably benign 0.23
R7241:Ift88 UTSW 14 57479997 missense probably damaging 0.97
R7243:Ift88 UTSW 14 57430536 critical splice acceptor site probably null
Predicted Primers PCR Primer
(F):5'- GTGGTCCTGAGAGACATGTG -3'
(R):5'- CCTGCACTTGATAATCAATGAGC -3'

Sequencing Primer
(F):5'- TCCTGAGAGACATGTGGTAATGC -3'
(R):5'- CACTTGATAATCAATGAGCAGAAGC -3'
Posted On2018-06-22