Incidental Mutation 'R6602:Msra'
ID525385
Institutional Source Beutler Lab
Gene Symbol Msra
Ensembl Gene ENSMUSG00000054733
Gene Namemethionine sulfoxide reductase A
Synonyms2310045J23Rik, MSR-A, 6530413P12Rik
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.129) question?
Stock #R6602 (G1)
Quality Score225.009
Status Validated
Chromosome14
Chromosomal Location64122625-64455903 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 64123339 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 184 (H184Q)
Ref Sequence ENSEMBL: ENSMUSP00000065754 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000067927] [ENSMUST00000210363] [ENSMUST00000210428]
PDB Structure
Solution structure of murine myristoylated msrA [SOLUTION NMR]
Predicted Effect probably benign
Transcript: ENSMUST00000067927
AA Change: H184Q

PolyPhen 2 Score 0.008 (Sensitivity: 0.96; Specificity: 0.76)
SMART Domains Protein: ENSMUSP00000065754
Gene: ENSMUSG00000054733
AA Change: H184Q

DomainStartEndE-ValueType
low complexity region 2 15 N/A INTRINSIC
Pfam:PMSR 65 219 2.4e-68 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000210363
AA Change: H120Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect probably benign
Transcript: ENSMUST00000210428
AA Change: H142Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000225122
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.6%
  • 20x: 92.6%
Validation Efficiency 100% (43/43)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a ubiquitous and highly conserved protein that carries out the enzymatic reduction of methionine sulfoxide to methionine. Human and animal studies have shown the highest levels of expression in kidney and nervous tissue. The protein functions in the repair of oxidatively damaged proteins to restore biological activity. Alternative splicing results in multiple transcript variants. [provided by RefSeq, May 2014]
PHENOTYPE: Mice homozygous for disruptions in this allele display an increased sensitivity to oxidative stress, reductions in related enzyme levels, and reduced life spans. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 43 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2310022B05Rik A G 8: 124,639,254 L250P probably damaging Het
4921539E11Rik T C 4: 103,255,572 H12R probably benign Het
Abca4 A C 3: 122,138,501 Q268P probably benign Het
Adgrf5 T A 17: 43,450,304 N963K probably benign Het
Arl10 A G 13: 54,578,937 D176G probably damaging Het
Btnl1 T A 17: 34,385,748 M501K probably damaging Het
Ccdc162 G T 10: 41,615,980 T1079K probably benign Het
Cd163 T A 6: 124,311,635 W342R probably damaging Het
Cd70 T C 17: 57,149,562 S14G probably benign Het
Chil4 C A 3: 106,210,590 K121N probably benign Het
Csf1r A G 18: 61,110,425 D171G possibly damaging Het
Cyp4a31 A T 4: 115,569,707 probably null Het
D3Ertd254e G T 3: 36,164,855 L341F possibly damaging Het
Dapk1 A T 13: 60,749,204 I746F probably benign Het
Erbb4 A G 1: 68,370,503 S192P probably damaging Het
Exoc8 C A 8: 124,896,411 V406L probably damaging Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Greb1 A T 12: 16,709,440 V652E probably benign Het
Ift88 A G 14: 57,507,259 S745G probably benign Het
Il18bp T C 7: 102,016,030 probably benign Het
Il6st A G 13: 112,504,413 T908A probably damaging Het
Klk11 A G 7: 43,774,774 S6G probably benign Het
Mastl T C 2: 23,132,677 Y678C probably benign Het
Muc16 A C 9: 18,609,476 probably null Het
Myo3a T G 2: 22,577,787 L351R probably damaging Het
Npy5r GCTGTGAAACACTG GCTG 8: 66,681,540 probably null Het
Olfr463 T C 11: 87,893,652 T91A probably benign Het
Olfr830 A G 9: 18,875,849 D174G possibly damaging Het
Olfr867 C T 9: 20,055,046 R139Q probably benign Het
Pcdhb18 A T 18: 37,490,480 I288F probably damaging Het
Pitpna T G 11: 75,620,315 V238G possibly damaging Het
Ppfibp1 T A 6: 146,978,221 V81E possibly damaging Het
Rab11fip2 T A 19: 59,942,856 T49S probably damaging Het
Rsl24d1 T A 9: 73,113,510 I3N possibly damaging Het
Rtn1 T C 12: 72,219,318 N161S probably damaging Het
Shank1 A G 7: 44,352,336 I1151V probably benign Het
Slc34a3 A G 2: 25,229,209 S550P probably damaging Het
Slc4a1ap A G 5: 31,527,641 H207R probably damaging Het
Sphkap T A 1: 83,275,758 K1423N possibly damaging Het
Ttn A G 2: 76,881,753 probably benign Het
Ubqln5 T A 7: 104,129,489 S43C probably benign Het
Vps13d G A 4: 145,103,664 probably benign Het
Wwp1 A T 4: 19,641,816 V413D probably damaging Het
Other mutations in Msra
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00898:Msra APN 14 64123325 missense probably damaging 0.99
IGL01301:Msra APN 14 64210435 missense probably damaging 1.00
IGL02500:Msra APN 14 64285188 splice site probably benign
IGL03227:Msra APN 14 64313743 missense probably benign 0.06
ANU18:Msra UTSW 14 64210435 missense probably damaging 1.00
R0485:Msra UTSW 14 64440761 missense possibly damaging 0.64
R0632:Msra UTSW 14 64210532 missense probably benign 0.04
R1557:Msra UTSW 14 64123326 missense possibly damaging 0.75
R1940:Msra UTSW 14 64285056 splice site probably benign
R2133:Msra UTSW 14 64233928 missense probably damaging 1.00
R2135:Msra UTSW 14 64123208 missense probably damaging 1.00
R6119:Msra UTSW 14 64440734 missense probably damaging 1.00
R7233:Msra UTSW 14 64123265 missense probably damaging 1.00
R7249:Msra UTSW 14 64440763 missense probably benign 0.17
Predicted Primers PCR Primer
(F):5'- GAATCACAGCAGTGCCACTC -3'
(R):5'- CCAGGCAGATTGATAAGTACCCATC -3'

Sequencing Primer
(F):5'- ATGGAACCTTCAGGGACAGCTTC -3'
(R):5'- CCATCTAGAATGATCCAGCATTAAGG -3'
Posted On2018-06-22