Incidental Mutation 'R6636:R3hdm1'
ID525425
Institutional Source Beutler Lab
Gene Symbol R3hdm1
Ensembl Gene ENSMUSG00000056211
Gene NameR3H domain containing 1
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.182) question?
Stock #R6636 (G1)
Quality Score217.468
Status Validated
Chromosome1
Chromosomal Location128103301-128237736 bp(+) (GRCm38)
Type of Mutationframe shift
DNA Base Change (assembly) GAA to GAAA at 128162811 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000140175 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000036288] [ENSMUST00000187023] [ENSMUST00000187900] [ENSMUST00000188381] [ENSMUST00000189317]
Predicted Effect probably null
Transcript: ENSMUST00000036288
SMART Domains Protein: ENSMUSP00000043103
Gene: ENSMUSG00000056211

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 8.8e-15 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
low complexity region 624 642 N/A INTRINSIC
low complexity region 909 927 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000187023
SMART Domains Protein: ENSMUSP00000139749
Gene: ENSMUSG00000056211

DomainStartEndE-ValueType
R3H 95 172 1.9e-24 SMART
Pfam:SUZ 193 246 2.6e-11 PFAM
low complexity region 335 368 N/A INTRINSIC
low complexity region 455 478 N/A INTRINSIC
Predicted Effect probably null
Transcript: ENSMUST00000187900
SMART Domains Protein: ENSMUSP00000141142
Gene: ENSMUSG00000056211

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 68 82 N/A INTRINSIC
low complexity region 86 99 N/A INTRINSIC
R3H 151 228 3.18e-22 SMART
Pfam:SUZ 249 302 2.7e-14 PFAM
low complexity region 391 424 N/A INTRINSIC
low complexity region 511 534 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000188381
SMART Domains Protein: ENSMUSP00000140538
Gene: ENSMUSG00000056211

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
R3H 107 184 3.18e-22 SMART
Predicted Effect probably null
Transcript: ENSMUST00000189317
SMART Domains Protein: ENSMUSP00000140175
Gene: ENSMUSG00000056211

DomainStartEndE-ValueType
coiled coil region 9 31 N/A INTRINSIC
low complexity region 72 85 N/A INTRINSIC
R3H 137 214 1.9e-24 SMART
Pfam:SUZ 235 287 2e-11 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000191016
Predicted Effect noncoding transcript
Transcript: ENSMUST00000194793
Meta Mutation Damage Score 0.6424 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (41/42)
Allele List at MGI
Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,787,402 V513A probably damaging Het
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
AY761185 T A 8: 20,944,540 probably null Het
C3ar1 T C 6: 122,851,054 D68G probably damaging Het
Cdh10 A T 15: 18,985,173 I308F probably damaging Het
Coq8a A T 1: 180,178,987 S112T probably benign Het
Diexf A T 1: 193,113,767 F197I probably damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fryl C A 5: 73,133,312 R83L probably benign Het
Gm4861 C T 3: 137,550,999 probably null Het
Gnai1 T C 5: 18,273,474 D231G probably damaging Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Hgd A G 16: 37,615,374 N149S possibly damaging Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Lama2 C A 10: 27,124,568 V1653L probably benign Het
Lamc1 A T 1: 153,241,975 I947N possibly damaging Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Nmbr T C 10: 14,770,234 S168P probably benign Het
Nsl1 A G 1: 191,075,127 T168A probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Olfr284 A G 15: 98,340,950 F13S probably benign Het
Pde1c A C 6: 56,180,102 V191G probably damaging Het
Proc T A 18: 32,123,760 I285F probably benign Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Spa17 A T 9: 37,611,974 S6T probably benign Het
Spp1 T C 5: 104,440,530 V267A possibly damaging Het
Stk17b A T 1: 53,761,088 Y244N probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Tmcc3 T A 10: 94,578,424 V27E probably benign Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Trim33 C T 3: 103,353,719 A1061V probably damaging Het
Ttll1 C G 15: 83,499,946 W160S probably damaging Het
Wnt7a A G 6: 91,394,558 Y141H probably benign Het
Other mutations in R3hdm1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00757:R3hdm1 APN 1 128236439 missense probably damaging 1.00
IGL00799:R3hdm1 APN 1 128174963 missense probably damaging 1.00
IGL00835:R3hdm1 APN 1 128235632 splice site probably benign
IGL00885:R3hdm1 APN 1 128236438 missense probably damaging 0.99
IGL00990:R3hdm1 APN 1 128162196 intron probably benign
IGL01137:R3hdm1 APN 1 128181875 missense probably damaging 1.00
IGL01323:R3hdm1 APN 1 128216543 missense probably benign
IGL01461:R3hdm1 APN 1 128178906 missense probably damaging 1.00
IGL01565:R3hdm1 APN 1 128186816 missense probably damaging 1.00
IGL01813:R3hdm1 APN 1 128175233 critical splice donor site probably null
IGL01837:R3hdm1 APN 1 128186760 nonsense probably null
IGL01934:R3hdm1 APN 1 128236535 missense probably benign 0.12
IGL02074:R3hdm1 APN 1 128169038 missense possibly damaging 0.48
IGL02532:R3hdm1 APN 1 128197099 critical splice donor site probably null
IGL02606:R3hdm1 APN 1 128190719 missense probably benign 0.00
IGL02851:R3hdm1 APN 1 128174940 splice site probably benign
driven UTSW 1 128193565 missense probably benign 0.00
R0023:R3hdm1 UTSW 1 128211192 splice site probably benign
R0280:R3hdm1 UTSW 1 128162775 missense probably benign 0.00
R0482:R3hdm1 UTSW 1 128184517 missense probably benign 0.12
R0521:R3hdm1 UTSW 1 128193703 missense probably benign 0.07
R0578:R3hdm1 UTSW 1 128231437 nonsense probably null
R0698:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0701:R3hdm1 UTSW 1 128181739 missense probably damaging 1.00
R0961:R3hdm1 UTSW 1 128193596 missense probably benign 0.13
R1026:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1141:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1319:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1320:R3hdm1 UTSW 1 128231405 missense probably benign 0.01
R1511:R3hdm1 UTSW 1 128197005 missense probably damaging 1.00
R1705:R3hdm1 UTSW 1 128235084 missense probably damaging 1.00
R1991:R3hdm1 UTSW 1 128169016 missense probably damaging 0.99
R2140:R3hdm1 UTSW 1 128190693 missense probably damaging 0.99
R2437:R3hdm1 UTSW 1 128186836 missense probably damaging 0.98
R2447:R3hdm1 UTSW 1 128186929 intron probably benign
R4564:R3hdm1 UTSW 1 128221659 missense probably benign 0.16
R4640:R3hdm1 UTSW 1 128175238 splice site probably benign
R4649:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4650:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4652:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4653:R3hdm1 UTSW 1 128184444 missense probably damaging 1.00
R4696:R3hdm1 UTSW 1 128236766 utr 3 prime probably benign
R5393:R3hdm1 UTSW 1 128231347 missense probably benign
R5554:R3hdm1 UTSW 1 128236672 missense probably benign 0.27
R5979:R3hdm1 UTSW 1 128211223 missense probably benign 0.04
R6123:R3hdm1 UTSW 1 128169036 missense probably damaging 0.99
R6185:R3hdm1 UTSW 1 128151861 missense possibly damaging 0.93
R6618:R3hdm1 UTSW 1 128193565 missense probably benign 0.00
R6639:R3hdm1 UTSW 1 128162811 frame shift probably null
R6756:R3hdm1 UTSW 1 128162811 frame shift probably null
X0017:R3hdm1 UTSW 1 128167921 missense possibly damaging 0.92
X0020:R3hdm1 UTSW 1 128169033 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATTATGCCCATTCTTGCTATTGC -3'
(R):5'- CCACCTGGGATTTTGTTAACAAGTG -3'

Sequencing Primer
(F):5'- GGGGCTTTTGAATATGCC -3'
(R):5'- CTGGGATTTTGTTAACAAGTGTTAGC -3'
Posted On2018-06-22