Incidental Mutation 'R6603:Xrcc1'
ID525455
Institutional Source Beutler Lab
Gene Symbol Xrcc1
Ensembl Gene ENSMUSG00000051768
Gene NameX-ray repair complementing defective repair in Chinese hamster cells 1
SynonymsXrcc-1
MMRRC Submission
Accession Numbers
Is this an essential gene? Essential (E-score: 1.000) question?
Stock #R6603 (G1)
Quality Score225.009
Status Not validated
Chromosome7
Chromosomal Location24546289-24573440 bp(+) (GRCm38)
Type of Mutationnonsense
DNA Base Change (assembly) C to T at 24571034 bp
ZygosityHeterozygous
Amino Acid Change Glutamine to Stop codon at position 500 (Q500*)
Ref Sequence ENSEMBL: ENSMUSP00000146105 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000063249] [ENSMUST00000205573]
Predicted Effect probably null
Transcript: ENSMUST00000063249
AA Change: Q500*
SMART Domains Protein: ENSMUSP00000070995
Gene: ENSMUSG00000051768
AA Change: Q500*

DomainStartEndE-ValueType
Pfam:XRCC1_N 1 151 6.9e-66 PFAM
low complexity region 212 238 N/A INTRINSIC
low complexity region 278 294 N/A INTRINSIC
BRCT 317 393 8e-19 SMART
low complexity region 407 424 N/A INTRINSIC
low complexity region 444 459 N/A INTRINSIC
BRCT 538 617 5.5e-9 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205453
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205564
Predicted Effect probably null
Transcript: ENSMUST00000205573
AA Change: Q500*
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205575
Predicted Effect noncoding transcript
Transcript: ENSMUST00000205804
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206067
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206153
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206429
Predicted Effect noncoding transcript
Transcript: ENSMUST00000206538
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The protein encoded by this gene is involved in the efficient repair of DNA single-strand breaks formed by exposure to ionizing radiation and alkylating agents. This protein interacts with DNA ligase III, polymerase beta and poly (ADP-ribose) polymerase to participate in the base excision repair pathway. It may play a role in DNA processing during meiogenesis and recombination in germ cells. A rare microsatellite polymorphism in this gene is associated with cancer in patients of varying radiosensitivity. [provided by RefSeq, Jul 2008]
PHENOTYPE: Homozygous null mutants accumulate unrepaired DNA strand breaks in the egg cylinder, show increased cell death in epiblast, developmental arrest at embryonic day 6.5, morphological anomalies in visceral embryonic endoderm by day 7.5 and die by day 8.5. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 24,665,502 F167Y possibly damaging Het
Ap3d1 A G 10: 80,714,047 S755P probably benign Het
Aph1a A T 3: 95,895,496 N136I probably damaging Het
AU040320 T A 4: 126,792,253 N207K probably benign Het
Caprin1 A T 2: 103,775,511 D377E probably benign Het
Col18a1 A G 10: 77,063,977 probably null Het
Ddi2 T C 4: 141,683,870 N577S probably damaging Het
Dip2c T A 13: 9,654,588 probably null Het
Dmbt1 A T 7: 131,046,510 probably null Het
Fam13a T C 6: 58,987,189 K86R probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam208a A G 14: 27,446,386 Y295C probably damaging Het
Fam71e2 G A 7: 4,758,432 P427L possibly damaging Het
Fbxl8 A T 8: 105,268,210 D118V probably damaging Het
Git2 C A 5: 114,730,991 probably null Het
Gm17190 T G 13: 96,082,262 D35E possibly damaging Het
Gnb4 C T 3: 32,585,146 D333N probably damaging Het
Has2 T A 15: 56,668,572 D249V probably damaging Het
Ighv1-23 A G 12: 114,764,521 S94P probably damaging Het
Itpr2 A G 6: 146,347,171 I1029T probably damaging Het
Kctd16 T C 18: 40,258,491 I44T probably benign Het
Kpna1 A G 16: 36,029,520 probably null Het
Lonrf1 T A 8: 36,222,941 R654S probably damaging Het
Lrrc49 A C 9: 60,593,769 probably null Het
Miip T G 4: 147,865,923 K72T possibly damaging Het
Mink1 C T 11: 70,609,593 P782S probably damaging Het
Mpped2 A G 2: 106,866,977 T266A probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Naip1 C T 13: 100,423,158 G1113S probably benign Het
Nbr1 A G 11: 101,556,105 probably benign Het
Necab3 A T 2: 154,554,922 N46K probably damaging Het
Olfr570 A T 7: 102,900,414 I16F probably benign Het
Phtf1 C T 3: 103,993,873 R360C probably damaging Het
Plcl2 A G 17: 50,607,117 I385V probably benign Het
Prmt8 A T 6: 127,729,413 F138L probably benign Het
Prpf40a T G 2: 53,152,963 R436S probably damaging Het
Rab27b T A 18: 69,985,304 I181F probably damaging Het
Rasgrf1 A G 9: 89,910,257 E87G probably damaging Het
Scrib T A 15: 76,062,723 T674S probably benign Het
Slc9a4 A G 1: 40,623,504 S644G probably benign Het
Slc9a9 G A 9: 94,939,546 A329T probably damaging Het
Smc4 T C 3: 69,022,461 probably null Het
Sox7 T A 14: 63,948,188 H224Q probably benign Het
Spata31 T C 13: 64,922,665 S876P probably damaging Het
Syndig1 G A 2: 150,003,288 V244M probably damaging Het
Tas2r113 A T 6: 132,893,458 I150L probably benign Het
Tmem59l G A 8: 70,486,356 P56L probably benign Het
Tnfrsf8 A T 4: 145,292,598 D222E possibly damaging Het
Trim52 T C 14: 106,107,049 L47P probably damaging Het
Ttc34 T A 4: 154,839,305 I157K probably benign Het
Txndc16 A G 14: 45,151,767 F492S probably damaging Het
Ubr4 A G 4: 139,455,586 I428V probably benign Het
Vmn2r41 T A 7: 8,138,360 I702F probably damaging Het
Wdr12 T A 1: 60,082,624 H256L probably damaging Het
Xirp2 A G 2: 67,516,544 H3043R probably benign Het
Zfp583 T C 7: 6,325,476 N38S probably damaging Het
Other mutations in Xrcc1
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00427:Xrcc1 APN 7 24547884 critical splice donor site probably null
IGL01830:Xrcc1 APN 7 24573342 utr 3 prime probably benign
IGL02349:Xrcc1 APN 7 24567042 nonsense probably null
IGL02433:Xrcc1 APN 7 24565554 missense possibly damaging 0.96
IGL03131:Xrcc1 APN 7 24573294 nonsense probably null
Bilberry UTSW 7 24570218 missense probably damaging 1.00
R0090:Xrcc1 UTSW 7 24570217 missense probably damaging 0.99
R0517:Xrcc1 UTSW 7 24570319 splice site probably benign
R0612:Xrcc1 UTSW 7 24570319 splice site probably benign
R1234:Xrcc1 UTSW 7 24567845 missense possibly damaging 0.71
R1577:Xrcc1 UTSW 7 24565627 nonsense probably null
R1796:Xrcc1 UTSW 7 24547827 missense probably damaging 1.00
R1863:Xrcc1 UTSW 7 24570575 missense possibly damaging 0.65
R3788:Xrcc1 UTSW 7 24566908 missense probably benign 0.08
R3794:Xrcc1 UTSW 7 24570560 missense probably benign 0.05
R4806:Xrcc1 UTSW 7 24570480 missense probably benign 0.14
R5206:Xrcc1 UTSW 7 24567563 missense probably damaging 1.00
R5414:Xrcc1 UTSW 7 24570218 missense probably damaging 1.00
R5532:Xrcc1 UTSW 7 24567928 critical splice donor site probably null
R5624:Xrcc1 UTSW 7 24559845 missense possibly damaging 0.57
R5990:Xrcc1 UTSW 7 24567868 missense probably damaging 1.00
R6669:Xrcc1 UTSW 7 24547337 missense probably damaging 1.00
R6716:Xrcc1 UTSW 7 24567146 critical splice donor site probably null
R6881:Xrcc1 UTSW 7 24547351 nonsense probably null
R7227:Xrcc1 UTSW 7 24547332 missense probably damaging 1.00
X0019:Xrcc1 UTSW 7 24573128 missense probably damaging 1.00
X0024:Xrcc1 UTSW 7 24573079 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- CCTGTTGACTGGGTTGCTAC -3'
(R):5'- CTGTCAGCAGGGGTAAAGTG -3'

Sequencing Primer
(F):5'- CTACTGGCAGAAGGACGGGAC -3'
(R):5'- CAGGGGTAAAGTGGGAGTCAC -3'
Posted On2018-06-22