Incidental Mutation 'R6603:Adam18'
ID525458
Institutional Source Beutler Lab
Gene Symbol Adam18
Ensembl Gene ENSMUSG00000031552
Gene Namea disintegrin and metallopeptidase domain 18
SynonymsAdam27, Dtgn3
MMRRC Submission
Accession Numbers

Genbank: NM_010084

Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6603 (G1)
Quality Score225.009
Status Not validated
Chromosome8
Chromosomal Location24602246-24674755 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 24665502 bp
ZygosityHeterozygous
Amino Acid Change Phenylalanine to Tyrosine at position 167 (F167Y)
Ref Sequence ENSEMBL: ENSMUSP00000033957 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000033957] [ENSMUST00000173833]
Predicted Effect possibly damaging
Transcript: ENSMUST00000033957
AA Change: F167Y

PolyPhen 2 Score 0.627 (Sensitivity: 0.87; Specificity: 0.91)
SMART Domains Protein: ENSMUSP00000033957
Gene: ENSMUSG00000031552
AA Change: F167Y

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 1.7e-25 PFAM
Pfam:Reprolysin 180 377 1.1e-57 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
transmembrane domain 684 703 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000173833
AA Change: F167Y

PolyPhen 2 Score 0.355 (Sensitivity: 0.90; Specificity: 0.89)
SMART Domains Protein: ENSMUSP00000133378
Gene: ENSMUSG00000031552
AA Change: F167Y

DomainStartEndE-ValueType
Pfam:Pep_M12B_propep 15 140 9.5e-35 PFAM
Pfam:Reprolysin 180 378 7.7e-56 PFAM
DISIN 396 474 1.03e-35 SMART
ACR 475 613 1.12e-51 SMART
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: This gene encodes a member of a disintegrin and metalloprotease (ADAM) family of endoproteases that play important roles in various biological processes including cell signaling, adhesion and migration. This gene is expressed in a regulated fashion during early stages of spermatogenesis. The encoded preproprotein undergoes proteolytic processing to generate a mature, functional protein. This gene is located in a cluster of related ADAM genes on chromosome 8. [provided by RefSeq, May 2016]
PHENOTYPE: Homozygous mutant mice exhibit enhanced motor coordination during inverted screen testing when compared with that of controls. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, other(1)

Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ap3d1 A G 10: 80,714,047 S755P probably benign Het
Aph1a A T 3: 95,895,496 N136I probably damaging Het
AU040320 T A 4: 126,792,253 N207K probably benign Het
Caprin1 A T 2: 103,775,511 D377E probably benign Het
Col18a1 A G 10: 77,063,977 probably null Het
Ddi2 T C 4: 141,683,870 N577S probably damaging Het
Dip2c T A 13: 9,654,588 probably null Het
Dmbt1 A T 7: 131,046,510 probably null Het
Fam13a T C 6: 58,987,189 K86R probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam208a A G 14: 27,446,386 Y295C probably damaging Het
Fam71e2 G A 7: 4,758,432 P427L possibly damaging Het
Fbxl8 A T 8: 105,268,210 D118V probably damaging Het
Git2 C A 5: 114,730,991 probably null Het
Gm17190 T G 13: 96,082,262 D35E possibly damaging Het
Gnb4 C T 3: 32,585,146 D333N probably damaging Het
Has2 T A 15: 56,668,572 D249V probably damaging Het
Ighv1-23 A G 12: 114,764,521 S94P probably damaging Het
Itpr2 A G 6: 146,347,171 I1029T probably damaging Het
Kctd16 T C 18: 40,258,491 I44T probably benign Het
Kpna1 A G 16: 36,029,520 probably null Het
Lonrf1 T A 8: 36,222,941 R654S probably damaging Het
Lrrc49 A C 9: 60,593,769 probably null Het
Miip T G 4: 147,865,923 K72T possibly damaging Het
Mink1 C T 11: 70,609,593 P782S probably damaging Het
Mpped2 A G 2: 106,866,977 T266A probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Naip1 C T 13: 100,423,158 G1113S probably benign Het
Nbr1 A G 11: 101,556,105 probably benign Het
Necab3 A T 2: 154,554,922 N46K probably damaging Het
Olfr570 A T 7: 102,900,414 I16F probably benign Het
Phtf1 C T 3: 103,993,873 R360C probably damaging Het
Plcl2 A G 17: 50,607,117 I385V probably benign Het
Prmt8 A T 6: 127,729,413 F138L probably benign Het
Prpf40a T G 2: 53,152,963 R436S probably damaging Het
Rab27b T A 18: 69,985,304 I181F probably damaging Het
Rasgrf1 A G 9: 89,910,257 E87G probably damaging Het
Scrib T A 15: 76,062,723 T674S probably benign Het
Slc9a4 A G 1: 40,623,504 S644G probably benign Het
Slc9a9 G A 9: 94,939,546 A329T probably damaging Het
Smc4 T C 3: 69,022,461 probably null Het
Sox7 T A 14: 63,948,188 H224Q probably benign Het
Spata31 T C 13: 64,922,665 S876P probably damaging Het
Syndig1 G A 2: 150,003,288 V244M probably damaging Het
Tas2r113 A T 6: 132,893,458 I150L probably benign Het
Tmem59l G A 8: 70,486,356 P56L probably benign Het
Tnfrsf8 A T 4: 145,292,598 D222E possibly damaging Het
Trim52 T C 14: 106,107,049 L47P probably damaging Het
Ttc34 T A 4: 154,839,305 I157K probably benign Het
Txndc16 A G 14: 45,151,767 F492S probably damaging Het
Ubr4 A G 4: 139,455,586 I428V probably benign Het
Vmn2r41 T A 7: 8,138,360 I702F probably damaging Het
Wdr12 T A 1: 60,082,624 H256L probably damaging Het
Xirp2 A G 2: 67,516,544 H3043R probably benign Het
Xrcc1 C T 7: 24,571,034 Q500* probably null Het
Zfp583 T C 7: 6,325,476 N38S probably damaging Het
Other mutations in Adam18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00470:Adam18 APN 8 24628133 missense probably damaging 1.00
IGL01649:Adam18 APN 8 24614896 missense possibly damaging 0.82
IGL02212:Adam18 APN 8 24637179 missense probably benign 0.02
IGL02455:Adam18 APN 8 24651848 missense probably damaging 0.96
IGL02525:Adam18 APN 8 24611044 missense probably benign 0.00
IGL02525:Adam18 APN 8 24641767 splice site probably benign
IGL02966:Adam18 APN 8 24611149 splice site probably benign
IGL03136:Adam18 APN 8 24641836 missense probably damaging 1.00
G5030:Adam18 UTSW 8 24651856 missense probably benign 0.24
R0135:Adam18 UTSW 8 24665542 missense possibly damaging 0.71
R0280:Adam18 UTSW 8 24674054 missense probably benign 0.06
R0389:Adam18 UTSW 8 24629637 splice site probably null
R0390:Adam18 UTSW 8 24674054 missense probably benign 0.06
R0443:Adam18 UTSW 8 24629637 splice site probably null
R0479:Adam18 UTSW 8 24651822 missense probably benign
R0578:Adam18 UTSW 8 24641847 missense possibly damaging 0.82
R0645:Adam18 UTSW 8 24672120 nonsense probably null
R0881:Adam18 UTSW 8 24672143 splice site probably benign
R0885:Adam18 UTSW 8 24651786 missense probably damaging 1.00
R0973:Adam18 UTSW 8 24647853 missense probably benign 0.01
R0973:Adam18 UTSW 8 24647853 missense probably benign 0.01
R0974:Adam18 UTSW 8 24647853 missense probably benign 0.01
R1005:Adam18 UTSW 8 24665514 missense probably benign 0.05
R1356:Adam18 UTSW 8 24668595 splice site probably benign
R1510:Adam18 UTSW 8 24625831 missense probably benign 0.01
R1552:Adam18 UTSW 8 24646361 missense probably benign
R1568:Adam18 UTSW 8 24647783 splice site probably null
R1639:Adam18 UTSW 8 24652152 missense probably benign 0.00
R1968:Adam18 UTSW 8 24646447 missense probably benign 0.32
R2029:Adam18 UTSW 8 24650877 missense probably damaging 1.00
R2058:Adam18 UTSW 8 24672066 splice site probably benign
R2211:Adam18 UTSW 8 24628155 missense probably damaging 0.96
R2237:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2238:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2239:Adam18 UTSW 8 24646287 missense probably benign 0.01
R2518:Adam18 UTSW 8 24637141 missense probably damaging 1.00
R3122:Adam18 UTSW 8 24628232 missense possibly damaging 0.74
R3426:Adam18 UTSW 8 24667604 missense probably damaging 1.00
R3428:Adam18 UTSW 8 24667604 missense probably damaging 1.00
R3967:Adam18 UTSW 8 24629710 missense probably benign 0.12
R4833:Adam18 UTSW 8 24674101 missense probably benign 0.01
R4965:Adam18 UTSW 8 24641811 missense probably damaging 1.00
R5249:Adam18 UTSW 8 24625852 missense probably benign 0.00
R5534:Adam18 UTSW 8 24665514 missense probably benign 0.05
R5920:Adam18 UTSW 8 24674075 missense probably damaging 1.00
R6329:Adam18 UTSW 8 24614827 missense probably damaging 1.00
R6450:Adam18 UTSW 8 24629675 missense probably benign 0.05
R6479:Adam18 UTSW 8 24629665 missense probably benign 0.29
R6516:Adam18 UTSW 8 24674687 missense probably damaging 1.00
R7194:Adam18 UTSW 8 24651852 missense possibly damaging 0.67
R7226:Adam18 UTSW 8 24647808 missense probably damaging 1.00
R7266:Adam18 UTSW 8 24667623 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- GGCTAATCTTCCTGCATTGTTTAATGG -3'
(R):5'- GCCTTTCTACATTTAGGGGATTCC -3'

Sequencing Primer
(F):5'- ATGGTTTCCAATAACAAATGTTTCC -3'
(R):5'- TCCTGCAGTTGGAAAATGTCAGC -3'
Posted On2018-06-22