Incidental Mutation 'R6603:Fbxl8'
ID525465
Institutional Source Beutler Lab
Gene Symbol Fbxl8
Ensembl Gene ENSMUSG00000033313
Gene NameF-box and leucine-rich repeat protein 8
SynonymsFBL8
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6603 (G1)
Quality Score216.009
Status Not validated
Chromosome8
Chromosomal Location105264648-105269326 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to T at 105268210 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Valine at position 118 (D118V)
Ref Sequence ENSEMBL: ENSMUSP00000038638 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000034359] [ENSMUST00000036127] [ENSMUST00000036221] [ENSMUST00000126923] [ENSMUST00000144762] [ENSMUST00000163734] [ENSMUST00000172525] [ENSMUST00000173102] [ENSMUST00000173640] [ENSMUST00000173859] [ENSMUST00000174837]
Predicted Effect probably benign
Transcript: ENSMUST00000034359
SMART Domains Protein: ENSMUSP00000034359
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
Pfam:TRADD_N 51 161 2.9e-49 PFAM
DEATH 203 303 1.14e-17 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000036127
SMART Domains Protein: ENSMUSP00000048904
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 383 8e-88 BLAST
Predicted Effect probably damaging
Transcript: ENSMUST00000036221
AA Change: D118V

PolyPhen 2 Score 0.977 (Sensitivity: 0.76; Specificity: 0.96)
SMART Domains Protein: ENSMUSP00000038638
Gene: ENSMUSG00000033313
AA Change: D118V

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
low complexity region 102 113 N/A INTRINSIC
low complexity region 252 263 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000126923
SMART Domains Protein: ENSMUSP00000115366
Gene: ENSMUSG00000033313

DomainStartEndE-ValueType
FBOX 8 48 2.72e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000144762
SMART Domains Protein: ENSMUSP00000119174
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
PDB:1F2H|A 1 50 7e-23 PDB
SCOP:d1f3va_ 8 50 4e-24 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000147670
SMART Domains Protein: ENSMUSP00000115535
Gene: ENSMUSG00000031887

DomainStartEndE-ValueType
PDB:1F2H|A 1 56 6e-23 PDB
SCOP:d1f3va_ 8 50 1e-23 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000163734
SMART Domains Protein: ENSMUSP00000126278
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 9 60 1.43e-1 SMART
Blast:HSF 99 323 2e-88 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000172525
SMART Domains Protein: ENSMUSP00000134206
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 243 3e-36 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173102
Predicted Effect probably benign
Transcript: ENSMUST00000173640
SMART Domains Protein: ENSMUSP00000133532
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 284 1e-50 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000173859
SMART Domains Protein: ENSMUSP00000134213
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 353 1e-46 BLAST
Predicted Effect probably benign
Transcript: ENSMUST00000174837
SMART Domains Protein: ENSMUSP00000134477
Gene: ENSMUSG00000033249

DomainStartEndE-ValueType
HSF 16 120 1.74e-62 SMART
Blast:HSF 159 290 3e-50 BLAST
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a member of the F-box protein family which is characterized by an approximately 40 amino acid motif, the F-box. The F-box proteins constitute one of the four subunits of the ubiquitin protein ligase complex called SCFs (SKP1-cullin-F-box), which function in phosphorylation-dependent ubiquitination. The F-box proteins are divided into 3 classes: Fbws containing WD-40 domains, Fbls containing leucine-rich repeats, and Fbxs containing either different protein-protein interaction modules or no recognizable motifs. The protein encoded by this gene belongs to the Fbls class. It shares 78% sequence identity with the mouse protein. [provided by RefSeq, Jul 2008]
Allele List at MGI
Other mutations in this stock
Total: 56 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adam18 A T 8: 24,665,502 F167Y possibly damaging Het
Ap3d1 A G 10: 80,714,047 S755P probably benign Het
Aph1a A T 3: 95,895,496 N136I probably damaging Het
AU040320 T A 4: 126,792,253 N207K probably benign Het
Caprin1 A T 2: 103,775,511 D377E probably benign Het
Col18a1 A G 10: 77,063,977 probably null Het
Ddi2 T C 4: 141,683,870 N577S probably damaging Het
Dip2c T A 13: 9,654,588 probably null Het
Dmbt1 A T 7: 131,046,510 probably null Het
Fam13a T C 6: 58,987,189 K86R probably benign Het
Fam168b C A 1: 34,836,741 G21V probably damaging Het
Fam208a A G 14: 27,446,386 Y295C probably damaging Het
Fam71e2 G A 7: 4,758,432 P427L possibly damaging Het
Git2 C A 5: 114,730,991 probably null Het
Gm17190 T G 13: 96,082,262 D35E possibly damaging Het
Gnb4 C T 3: 32,585,146 D333N probably damaging Het
Has2 T A 15: 56,668,572 D249V probably damaging Het
Ighv1-23 A G 12: 114,764,521 S94P probably damaging Het
Itpr2 A G 6: 146,347,171 I1029T probably damaging Het
Kctd16 T C 18: 40,258,491 I44T probably benign Het
Kpna1 A G 16: 36,029,520 probably null Het
Lonrf1 T A 8: 36,222,941 R654S probably damaging Het
Lrrc49 A C 9: 60,593,769 probably null Het
Miip T G 4: 147,865,923 K72T possibly damaging Het
Mink1 C T 11: 70,609,593 P782S probably damaging Het
Mpped2 A G 2: 106,866,977 T266A probably benign Het
Naip1 G A 13: 100,423,070 S1142F probably benign Het
Naip1 C T 13: 100,423,158 G1113S probably benign Het
Nbr1 A G 11: 101,556,105 probably benign Het
Necab3 A T 2: 154,554,922 N46K probably damaging Het
Olfr570 A T 7: 102,900,414 I16F probably benign Het
Phtf1 C T 3: 103,993,873 R360C probably damaging Het
Plcl2 A G 17: 50,607,117 I385V probably benign Het
Prmt8 A T 6: 127,729,413 F138L probably benign Het
Prpf40a T G 2: 53,152,963 R436S probably damaging Het
Rab27b T A 18: 69,985,304 I181F probably damaging Het
Rasgrf1 A G 9: 89,910,257 E87G probably damaging Het
Scrib T A 15: 76,062,723 T674S probably benign Het
Slc9a4 A G 1: 40,623,504 S644G probably benign Het
Slc9a9 G A 9: 94,939,546 A329T probably damaging Het
Smc4 T C 3: 69,022,461 probably null Het
Sox7 T A 14: 63,948,188 H224Q probably benign Het
Spata31 T C 13: 64,922,665 S876P probably damaging Het
Syndig1 G A 2: 150,003,288 V244M probably damaging Het
Tas2r113 A T 6: 132,893,458 I150L probably benign Het
Tmem59l G A 8: 70,486,356 P56L probably benign Het
Tnfrsf8 A T 4: 145,292,598 D222E possibly damaging Het
Trim52 T C 14: 106,107,049 L47P probably damaging Het
Ttc34 T A 4: 154,839,305 I157K probably benign Het
Txndc16 A G 14: 45,151,767 F492S probably damaging Het
Ubr4 A G 4: 139,455,586 I428V probably benign Het
Vmn2r41 T A 7: 8,138,360 I702F probably damaging Het
Wdr12 T A 1: 60,082,624 H256L probably damaging Het
Xirp2 A G 2: 67,516,544 H3043R probably benign Het
Xrcc1 C T 7: 24,571,034 Q500* probably null Het
Zfp583 T C 7: 6,325,476 N38S probably damaging Het
Other mutations in Fbxl8
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL02794:Fbxl8 APN 8 105268120 missense probably benign 0.01
IGL03405:Fbxl8 APN 8 105268120 missense probably benign 0.07
R0993:Fbxl8 UTSW 8 105267085 missense probably damaging 1.00
R1861:Fbxl8 UTSW 8 105268929 missense probably damaging 1.00
R2042:Fbxl8 UTSW 8 105268224 missense probably damaging 0.96
R3848:Fbxl8 UTSW 8 105267149 missense probably benign 0.04
R3850:Fbxl8 UTSW 8 105267149 missense probably benign 0.04
R4957:Fbxl8 UTSW 8 105268195 missense probably damaging 0.99
R5153:Fbxl8 UTSW 8 105267107 missense probably damaging 1.00
R5161:Fbxl8 UTSW 8 105268906 missense possibly damaging 0.71
R6597:Fbxl8 UTSW 8 105268891 missense probably benign 0.00
R6962:Fbxl8 UTSW 8 105268706 missense possibly damaging 0.71
R7044:Fbxl8 UTSW 8 105267015 start codon destroyed probably null 0.99
Predicted Primers PCR Primer
(F):5'- AGACTTGTTGCCACCATATCTGTC -3'
(R):5'- ACAGGCCTCCAGTAGTTTGAG -3'

Sequencing Primer
(F):5'- GTCCTCCTGCCTGGACCAC -3'
(R):5'- CCTCCAGTAGTTTGAGCACAG -3'
Posted On2018-06-22