Incidental Mutation 'R6636:Nmbr'
ID525470
Institutional Source Beutler Lab
Gene Symbol Nmbr
Ensembl Gene ENSMUSG00000019865
Gene Nameneuromedin B receptor
Synonyms
MMRRC Submission
Accession Numbers

Genbank: NM_008703

Is this an essential gene? Probably non essential (E-score: 0.068) question?
Stock #R6636 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location14705591-14770850 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 14770234 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 168 (S168P)
Ref Sequence ENSEMBL: ENSMUSP00000140223 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000020015] [ENSMUST00000186382] [ENSMUST00000190114] [ENSMUST00000190751] [ENSMUST00000191238]
Predicted Effect probably benign
Transcript: ENSMUST00000020015
AA Change: V284A

PolyPhen 2 Score 0.085 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000020015
Gene: ENSMUSG00000019865
AA Change: V284A

DomainStartEndE-ValueType
Pfam:7TM_GPCR_Srsx 54 339 5.9e-9 PFAM
Pfam:7tm_1 60 325 2.9e-55 PFAM
Pfam:7TM_GPCR_Srv 92 341 2.6e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000186382
SMART Domains Protein: ENSMUSP00000139612
Gene: ENSMUSG00000019865

DomainStartEndE-ValueType
Pfam:7tm_1 60 257 1.4e-40 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190114
SMART Domains Protein: ENSMUSP00000140754
Gene: ENSMUSG00000019865

DomainStartEndE-ValueType
Pfam:7tm_1 8 119 6.8e-10 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000190751
AA Change: S168P

PolyPhen 2 Score 0.226 (Sensitivity: 0.91; Specificity: 0.88)
SMART Domains Protein: ENSMUSP00000140223
Gene: ENSMUSG00000019865
AA Change: S168P

DomainStartEndE-ValueType
Pfam:7tm_1 60 144 2.7e-21 PFAM
transmembrane domain 152 174 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000191238
Predicted Effect noncoding transcript
Transcript: ENSMUST00000220206
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.7%
  • 20x: 92.8%
Validation Efficiency 98% (41/42)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a 7-transmembrane G protein-coupled receptor that binds neuromedin B, which is a growth factor and mitogen for gastrointestinal epithelial tissue and for normal and neoplastic lung. This receptor may play a role in smooth muscle contraction, neuronal responses, and the regulation of cell growth. Antagonists of this receptor have a potential therapeutic use in inhibiting tumor cell growth. Polymorphisms in this gene may be associated with a susceptibility for schizophrenia. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Apr 2016]
PHENOTYPE: Mice homozygous for a knock-out allele show a 50% reduction in the thermoregulatory response to neuromedin B as well as impaired maternal behavior in response to restraint-induced stress. [provided by MGI curators]
Allele List at MGI

All alleles(1) : Targeted, knock-out(1)

Other mutations in this stock
Total: 42 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adcy8 A G 15: 64,787,402 V513A probably damaging Het
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
AY761185 T A 8: 20,944,540 probably null Het
C3ar1 T C 6: 122,851,054 D68G probably damaging Het
Cdh10 A T 15: 18,985,173 I308F probably damaging Het
Coq8a A T 1: 180,178,987 S112T probably benign Het
Diexf A T 1: 193,113,767 F197I probably damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fryl C A 5: 73,133,312 R83L probably benign Het
Gm4861 C T 3: 137,550,999 probably null Het
Gnai1 T C 5: 18,273,474 D231G probably damaging Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Hgd A G 16: 37,615,374 N149S possibly damaging Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Lama2 C A 10: 27,124,568 V1653L probably benign Het
Lamc1 A T 1: 153,241,975 I947N possibly damaging Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Nsl1 A G 1: 191,075,127 T168A probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Olfr284 A G 15: 98,340,950 F13S probably benign Het
Pde1c A C 6: 56,180,102 V191G probably damaging Het
Proc T A 18: 32,123,760 I285F probably benign Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rsf1 G GACGGCGGCT 7: 97,579,909 probably benign Homo
Spa17 A T 9: 37,611,974 S6T probably benign Het
Spp1 T C 5: 104,440,530 V267A possibly damaging Het
Stk17b A T 1: 53,761,088 Y244N probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Tmcc3 T A 10: 94,578,424 V27E probably benign Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Trim33 C T 3: 103,353,719 A1061V probably damaging Het
Ttll1 C G 15: 83,499,946 W160S probably damaging Het
Wnt7a A G 6: 91,394,558 Y141H probably benign Het
Other mutations in Nmbr
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01617:Nmbr APN 10 14770429 missense probably benign 0.19
IGL01874:Nmbr APN 10 14766952 missense probably benign 0.09
IGL02616:Nmbr APN 10 14760687 intron probably benign
IGL02619:Nmbr APN 10 14760587 missense probably damaging 0.99
IGL03015:Nmbr APN 10 14760668 missense probably damaging 1.00
G5030:Nmbr UTSW 10 14767003 missense possibly damaging 0.95
R0057:Nmbr UTSW 10 14760524 missense probably damaging 0.97
R0238:Nmbr UTSW 10 14770395 nonsense probably null
R0238:Nmbr UTSW 10 14770395 nonsense probably null
R0324:Nmbr UTSW 10 14760448 missense possibly damaging 0.50
R1252:Nmbr UTSW 10 14760443 missense probably benign 0.09
R1812:Nmbr UTSW 10 14760539 intron probably null
R1831:Nmbr UTSW 10 14766865 missense probably benign 0.36
R2140:Nmbr UTSW 10 14770442 nonsense probably null
R2141:Nmbr UTSW 10 14770442 nonsense probably null
R4604:Nmbr UTSW 10 14770164 missense probably damaging 1.00
R4936:Nmbr UTSW 10 14766986 missense probably damaging 1.00
R5965:Nmbr UTSW 10 14766810 missense probably benign 0.01
R6895:Nmbr UTSW 10 14769960 makesense probably null
Predicted Primers PCR Primer
(F):5'- TTTGGGAACATCTCATGCCC -3'
(R):5'- TTACTGCTGACGAGCTGAGG -3'

Sequencing Primer
(F):5'- GGAACATCTCATGCCCTGACTAAC -3'
(R):5'- ACCTCTCGGGATAGGACTTC -3'
Posted On2018-06-22