Incidental Mutation 'R6637:Cdh3'
ID525532
Institutional Source Beutler Lab
Gene Symbol Cdh3
Ensembl Gene ENSMUSG00000061048
Gene Namecadherin 3
SynonymsPcad, P-cadherin, Cadp
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.116) question?
Stock #R6637 (G1)
Quality Score135.008
Status Validated
Chromosome8
Chromosomal Location106510891-106557297 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to C at 106511341 bp
ZygosityHeterozygous
Amino Acid Change Valine to Leucine at position 56 (V56L)
Ref Sequence ENSEMBL: ENSMUSP00000079613 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000066875] [ENSMUST00000080797]
PDB Structure
Crystal structure of mouse P-cadherin extracellular domains EC1-EC2 [X-RAY DIFFRACTION]
Predicted Effect probably benign
Transcript: ENSMUST00000066875
SMART Domains Protein: ENSMUSP00000069776
Gene: ENSMUSG00000054069

DomainStartEndE-ValueType
signal peptide 1 18 N/A INTRINSIC
low complexity region 166 181 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000080797
AA Change: V56L

PolyPhen 2 Score 0.000 (Sensitivity: 1.00; Specificity: 0.00)
SMART Domains Protein: ENSMUSP00000079613
Gene: ENSMUSG00000061048
AA Change: V56L

DomainStartEndE-ValueType
signal peptide 1 25 N/A INTRINSIC
CA 122 205 7.57e-11 SMART
CA 229 318 1.68e-26 SMART
CA 341 431 4.21e-18 SMART
CA 454 538 1.28e-22 SMART
Pfam:Cadherin_C 673 818 3.9e-46 PFAM
Meta Mutation Damage Score 0.25 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.4%
  • 10x: 97.4%
  • 20x: 92.1%
Validation Efficiency 100% (34/34)
MGI Phenotype FUNCTION: This gene encodes a calcium-dependent cell-cell adhesion protein containing five cadherin domains. The encoded protein plays a role in epithelial outgrowth, such as that which occurs during the development of hair follicles and limb buds. Loss of function of the related gene in humans results in ectodermal dysplasia, ectrodactyly, and macular dystrophy and congential hypotrichosis with juvenile macular dystrophy. This gene is located in the vicinity of similar cadherin genes on chromosome 8. The proprotein is further cleaved into a functional chain. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Mar 2013]
PHENOTYPE: Homozygous mutation of this gene results in precocious development of mammary glands in virgin 10-week old females. Aged virgin females (24 weeks) exhibit alveolar hyperplasia, ductal dysplasia, and extensive lymphocyte infiltration of the mammary glands. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 35 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adgrl4 G A 3: 151,517,773 W621* probably null Het
Adh1 T A 3: 138,282,470 C98* probably null Het
Alms1 A G 6: 85,619,734 H514R possibly damaging Het
Ap4m1 A G 5: 138,172,175 probably benign Het
Atp6v1b2 T C 8: 69,101,374 Y68H probably damaging Het
Col3a1 C T 1: 45,347,730 T234I probably damaging Het
Cxadr C T 16: 78,333,503 T186M possibly damaging Het
Dmgdh A T 13: 93,709,198 E453D probably benign Het
Fbxo16 A G 14: 65,295,761 probably null Het
Fign A G 2: 64,027,908 probably benign Het
Hfe C G 13: 23,706,795 E120D possibly damaging Het
Hfe T C 13: 23,706,796 E120G possibly damaging Het
Invs G A 4: 48,416,203 probably null Het
Kcnb1 T C 2: 167,105,854 D358G probably damaging Het
Kcnk5 A C 14: 20,144,721 M183R probably null Het
Lamp3 A G 16: 19,701,233 F67L probably benign Het
Lrrc8b A C 5: 105,480,271 D161A possibly damaging Het
Lrriq1 A T 10: 103,221,432 F169Y probably benign Het
Lsamp T A 16: 41,533,381 V2D possibly damaging Het
Ltbp2 T C 12: 84,875,838 I132V probably benign Het
Muc4 C T 16: 32,753,964 P1280L probably benign Het
Muc5ac T C 7: 141,818,605 Y2659H possibly damaging Het
Olfr1095 T G 2: 86,851,440 K86T probably benign Het
Olfr1197 T C 2: 88,728,841 I253V probably benign Het
Olfr130 G A 17: 38,067,224 D18N probably damaging Het
Olfr1467 T C 19: 13,365,225 V199A probably benign Het
Spa17 A T 9: 37,611,974 S6T probably benign Het
Ston2 G C 12: 91,714,112 T126S probably damaging Het
Tal1 A G 4: 115,068,592 N286S probably damaging Het
Tbr1 A G 2: 61,811,630 D150G probably benign Het
Tgm7 T A 2: 121,101,090 R197S probably damaging Het
Topaz1 A T 9: 122,749,786 Q587L probably benign Het
Ubxn4 C A 1: 128,277,087 Q505K probably damaging Het
Vcl A G 14: 21,003,132 E405G probably damaging Het
Vmn2r26 A T 6: 124,061,691 I742F probably damaging Het
Other mutations in Cdh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01103:Cdh3 APN 8 106555305 missense probably damaging 1.00
IGL01431:Cdh3 APN 8 106547669 missense probably damaging 1.00
IGL01466:Cdh3 APN 8 106536595 missense possibly damaging 0.62
IGL01794:Cdh3 APN 8 106537126 missense possibly damaging 0.78
IGL02100:Cdh3 APN 8 106543690 missense probably benign
IGL02272:Cdh3 APN 8 106547836 splice site probably null
IGL02292:Cdh3 APN 8 106545201 missense probably damaging 0.99
IGL02553:Cdh3 APN 8 106544248 nonsense probably null
IGL03245:Cdh3 APN 8 106552999 missense probably damaging 1.00
IGL03376:Cdh3 APN 8 106541404 missense probably benign 0.01
PIT4486001:Cdh3 UTSW 8 106541490 missense possibly damaging 0.89
R0143:Cdh3 UTSW 8 106511225 missense probably benign 0.35
R0388:Cdh3 UTSW 8 106539129 missense probably damaging 1.00
R0462:Cdh3 UTSW 8 106555380 missense possibly damaging 0.65
R0526:Cdh3 UTSW 8 106555446 missense possibly damaging 0.69
R0788:Cdh3 UTSW 8 106541415 missense probably benign 0.05
R1495:Cdh3 UTSW 8 106538997 missense probably damaging 1.00
R1653:Cdh3 UTSW 8 106539068 missense probably damaging 1.00
R1806:Cdh3 UTSW 8 106536915 missense probably benign 0.02
R2124:Cdh3 UTSW 8 106552888 missense probably damaging 1.00
R2302:Cdh3 UTSW 8 106545069 missense probably damaging 1.00
R2326:Cdh3 UTSW 8 106511308 missense probably benign
R2508:Cdh3 UTSW 8 106552407 missense probably damaging 1.00
R3625:Cdh3 UTSW 8 106543678 missense probably damaging 0.98
R3767:Cdh3 UTSW 8 106536974 splice site probably null
R4679:Cdh3 UTSW 8 106539856 missense probably damaging 1.00
R4716:Cdh3 UTSW 8 106543888 missense probably benign
R4778:Cdh3 UTSW 8 106543826 missense probably damaging 0.98
R4928:Cdh3 UTSW 8 106536610 missense probably benign 0.15
R5069:Cdh3 UTSW 8 106536826 missense probably benign 0.19
R5101:Cdh3 UTSW 8 106541392 missense possibly damaging 0.60
R5204:Cdh3 UTSW 8 106544239 missense probably benign 0.29
R5309:Cdh3 UTSW 8 106539020 missense probably damaging 0.98
R5343:Cdh3 UTSW 8 106552936 missense probably benign
R5408:Cdh3 UTSW 8 106536637 missense probably damaging 0.98
R6253:Cdh3 UTSW 8 106537063 splice site probably null
R6639:Cdh3 UTSW 8 106511341 missense probably benign
R7142:Cdh3 UTSW 8 106545228 critical splice donor site probably null
R7371:Cdh3 UTSW 8 106552477 missense probably damaging 1.00
R7397:Cdh3 UTSW 8 106536609 nonsense probably null
R7458:Cdh3 UTSW 8 106537147 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- GAATCTTAGGGCTGTGCTCC -3'
(R):5'- AGAGCTGGACGTTAGTAGGC -3'

Sequencing Primer
(F):5'- GTGTACAGAACCAGGCATGCC -3'
(R):5'- TTAGTAGGCGCACCGTTGC -3'
Posted On2018-06-22