Incidental Mutation 'R6638:Cep112'
ID525595
Institutional Source Beutler Lab
Gene Symbol Cep112
Ensembl Gene ENSMUSG00000020728
Gene Namecentrosomal protein 112
SynonymsMacoco, 8430407H02Rik, Ccdc46, 1700001M19Rik, 1700029K01Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.397) question?
Stock #R6638 (G1)
Quality Score225.009
Status Not validated
Chromosome11
Chromosomal Location108425192-108860615 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 108855870 bp
ZygosityHeterozygous
Amino Acid Change Serine to Proline at position 980 (S980P)
Ref Sequence ENSEMBL: ENSMUSP00000122509 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000061287] [ENSMUST00000106715] [ENSMUST00000106718] [ENSMUST00000106724] [ENSMUST00000130515] [ENSMUST00000132978] [ENSMUST00000133670] [ENSMUST00000150863] [ENSMUST00000182729]
Predicted Effect possibly damaging
Transcript: ENSMUST00000061287
AA Change: S928P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000050597
Gene: ENSMUSG00000020728
AA Change: S928P

DomainStartEndE-ValueType
Pfam:DUF4485 13 98 4.8e-31 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 954 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106715
AA Change: S147P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102326
Gene: ENSMUSG00000020728
AA Change: S147P

DomainStartEndE-ValueType
coiled coil region 11 158 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106718
AA Change: S126P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102329
Gene: ENSMUSG00000020728
AA Change: S126P

DomainStartEndE-ValueType
coiled coil region 26 173 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000106724
AA Change: S76P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000102335
Gene: ENSMUSG00000020728
AA Change: S76P

DomainStartEndE-ValueType
coiled coil region 64 102 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000129814
Predicted Effect possibly damaging
Transcript: ENSMUST00000130515
AA Change: S928P

PolyPhen 2 Score 0.930 (Sensitivity: 0.81; Specificity: 0.94)
SMART Domains Protein: ENSMUSP00000114569
Gene: ENSMUSG00000020728
AA Change: S928P

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.8e-31 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 954 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000132978
AA Change: S185P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000138124
Gene: ENSMUSG00000020728
AA Change: S185P

DomainStartEndE-ValueType
coiled coil region 54 155 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000133670
AA Change: S583P

PolyPhen 2 Score 0.998 (Sensitivity: 0.27; Specificity: 0.99)
SMART Domains Protein: ENSMUSP00000114627
Gene: ENSMUSG00000020728
AA Change: S583P

DomainStartEndE-ValueType
low complexity region 10 29 N/A INTRINSIC
internal_repeat_2 66 104 4.9e-5 PROSPERO
internal_repeat_1 81 110 2.63e-5 PROSPERO
coiled coil region 123 203 N/A INTRINSIC
internal_repeat_3 252 264 4.9e-5 PROSPERO
low complexity region 317 328 N/A INTRINSIC
internal_repeat_2 332 370 4.9e-5 PROSPERO
internal_repeat_3 532 544 4.9e-5 PROSPERO
internal_repeat_1 540 569 2.63e-5 PROSPERO
coiled coil region 571 609 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000150863
AA Change: S980P

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000122509
Gene: ENSMUSG00000020728
AA Change: S980P

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 6.8e-28 PFAM
coiled coil region 275 341 N/A INTRINSIC
coiled coil region 397 477 N/A INTRINSIC
coiled coil region 504 566 N/A INTRINSIC
Predicted Effect probably damaging
Transcript: ENSMUST00000182729
AA Change: S886P

PolyPhen 2 Score 0.990 (Sensitivity: 0.72; Specificity: 0.97)
SMART Domains Protein: ENSMUSP00000138235
Gene: ENSMUSG00000020728
AA Change: S886P

DomainStartEndE-ValueType
Pfam:DUF4485 12 99 5.4e-31 PFAM
coiled coil region 233 299 N/A INTRINSIC
coiled coil region 355 435 N/A INTRINSIC
coiled coil region 462 912 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000182735
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.7%
  • 20x: 92.9%
Validation Efficiency
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a coiled-coil domain containing protein that belongs to the cell division control protein 42 effector protein family. In neurons, it localizes to the cytoplasm of dendrites and is also enriched in the nucleus where it interacts with the RNA polymerase III transcriptional repressor Maf1 to regulate gamma-aminobutyric acid A receptor surface expression. In addition, the protein has been identified as a component of the human centrosome. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
Allele List at MGI
Other mutations in this stock
Total: 28 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
2210408I21Rik T A 13: 77,303,402 N868K probably benign Het
Dlk1 A G 12: 109,460,278 E95G probably damaging Het
Dnah6 A T 6: 73,035,280 probably null Het
Dppa2 A T 16: 48,314,160 H118L possibly damaging Het
Eif4enif1 T C 11: 3,242,463 S740P probably damaging Het
Eva1b T C 4: 126,149,472 S102P probably benign Het
Fndc3a G A 14: 72,559,248 R637* probably null Het
Fras1 A T 5: 96,758,094 D3119V possibly damaging Het
Hmgcr T C 13: 96,658,982 T360A probably benign Het
Kif21a A G 15: 90,966,407 V1017A probably damaging Het
Lats2 A G 14: 57,699,365 S556P probably damaging Het
Lrrc7 A G 3: 158,135,303 F1366S probably benign Het
Mtmr2 C A 9: 13,796,133 A327E probably damaging Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Olfr823 T C 10: 130,111,870 T307A probably benign Het
Ovch2 A T 7: 107,789,094 H426Q probably benign Het
Plxna1 A T 6: 89,324,400 V1506E probably damaging Het
Poldip3 A T 15: 83,133,200 S225T probably damaging Het
Polr3h A G 15: 81,918,304 L108P possibly damaging Het
Prss44 G A 9: 110,817,203 V333M probably damaging Het
Ptprk C T 10: 28,595,811 R1432C probably damaging Het
Rpl36al A G 12: 69,182,934 L68P probably damaging Het
Tagap T C 17: 7,927,074 S26P possibly damaging Het
Vapb A G 2: 173,771,569 K87R probably damaging Het
Vmn1r35 G A 6: 66,678,864 T274I possibly damaging Het
Wdsub1 A T 2: 59,870,441 probably benign Het
Xrcc5 C T 1: 72,383,362 S651L possibly damaging Het
Zfyve27 T A 19: 42,181,497 probably null Het
Other mutations in Cep112
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00679:Cep112 APN 11 108591053 missense probably damaging 1.00
IGL00705:Cep112 APN 11 108472033 missense probably benign
IGL00848:Cep112 APN 11 108472060 missense probably damaging 1.00
IGL00975:Cep112 APN 11 108434186 missense probably damaging 1.00
IGL01085:Cep112 APN 11 108486606 missense probably damaging 1.00
IGL01286:Cep112 APN 11 108859409 critical splice donor site probably null
IGL01536:Cep112 APN 11 108531411 missense probably null 0.08
IGL02622:Cep112 APN 11 108518683 missense probably benign 0.26
IGL02720:Cep112 APN 11 108859351 missense probably damaging 0.98
FR4976:Cep112 UTSW 11 108425352 unclassified probably benign
PIT4466001:Cep112 UTSW 11 108519896 missense probably benign
R0727:Cep112 UTSW 11 108506554 missense probably damaging 1.00
R0907:Cep112 UTSW 11 108570432 splice site probably benign
R0908:Cep112 UTSW 11 108664497 missense possibly damaging 0.69
R1236:Cep112 UTSW 11 108859374 missense probably damaging 1.00
R1514:Cep112 UTSW 11 108472054 missense probably damaging 1.00
R2049:Cep112 UTSW 11 108606325 missense probably damaging 0.96
R2058:Cep112 UTSW 11 108519261 critical splice donor site probably null
R2059:Cep112 UTSW 11 108519261 critical splice donor site probably null
R2126:Cep112 UTSW 11 108508258 missense probably damaging 0.98
R2142:Cep112 UTSW 11 108606325 missense probably damaging 0.96
R2196:Cep112 UTSW 11 108570361 missense probably damaging 0.98
R2276:Cep112 UTSW 11 108855845 missense probably damaging 1.00
R2414:Cep112 UTSW 11 108752582 missense possibly damaging 0.91
R2655:Cep112 UTSW 11 108437201 splice site probably benign
R2882:Cep112 UTSW 11 108519212 missense possibly damaging 0.94
R3001:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R3002:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R3003:Cep112 UTSW 11 108440503 missense probably damaging 1.00
R4407:Cep112 UTSW 11 108519201 missense possibly damaging 0.93
R4796:Cep112 UTSW 11 108486992 critical splice donor site probably null
R4898:Cep112 UTSW 11 108506645 missense probably damaging 0.96
R4899:Cep112 UTSW 11 108606284 missense probably damaging 0.96
R4977:Cep112 UTSW 11 108434236 missense probably damaging 0.97
R5021:Cep112 UTSW 11 108470328 missense possibly damaging 0.86
R5186:Cep112 UTSW 11 108752560 missense probably benign 0.00
R5462:Cep112 UTSW 11 108518744 missense probably damaging 1.00
R5494:Cep112 UTSW 11 108664605 missense probably damaging 1.00
R5506:Cep112 UTSW 11 108664603 missense probably damaging 1.00
R5560:Cep112 UTSW 11 108437235 missense probably damaging 1.00
R5682:Cep112 UTSW 11 108470312 missense probably damaging 1.00
R5857:Cep112 UTSW 11 108531471 splice site probably benign
R5863:Cep112 UTSW 11 108606232 missense probably damaging 1.00
R5884:Cep112 UTSW 11 108570316 missense probably damaging 0.99
R5913:Cep112 UTSW 11 108757688 missense probably damaging 0.99
R6344:Cep112 UTSW 11 108519174 missense probably damaging 0.98
R6498:Cep112 UTSW 11 108440531 missense probably benign 0.25
R6611:Cep112 UTSW 11 108506551 missense possibly damaging 0.71
R6916:Cep112 UTSW 11 108859376 missense probably damaging 1.00
R7182:Cep112 UTSW 11 108682844 missense probably benign 0.07
R7262:Cep112 UTSW 11 108664641 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GCCATGCTAGTACATGCTTTCTG -3'
(R):5'- GGCTGTGAATGAATCTGACCC -3'

Sequencing Primer
(F):5'- ACATGCTTTCTGACAATAAAGAGAG -3'
(R):5'- CTGACCCAGTTTTAGGAGACTAGC -3'
Posted On2018-06-22