Incidental Mutation 'R6605:Prdm4'
ID525610
Institutional Source Beutler Lab
Gene Symbol Prdm4
Ensembl Gene ENSMUSG00000035529
Gene NamePR domain containing 4
Synonyms2810470D21Rik, SC-1, 1700031E19Rik
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6605 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location85891966-85917142 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) A to G at 85904138 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 459 (V459A)
Ref Sequence ENSEMBL: ENSMUSP00000041942 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000037646] [ENSMUST00000218969] [ENSMUST00000219370] [ENSMUST00000220032]
Predicted Effect probably benign
Transcript: ENSMUST00000037646
AA Change: V459A

PolyPhen 2 Score 0.005 (Sensitivity: 0.97; Specificity: 0.74)
SMART Domains Protein: ENSMUSP00000041942
Gene: ENSMUSG00000035529
AA Change: V459A

DomainStartEndE-ValueType
low complexity region 14 28 N/A INTRINSIC
low complexity region 33 44 N/A INTRINSIC
low complexity region 51 69 N/A INTRINSIC
low complexity region 339 353 N/A INTRINSIC
PDB:3DB5|B 386 543 2e-98 PDB
Blast:SET 408 538 5e-82 BLAST
ZnF_C2H2 548 569 7.77e1 SMART
low complexity region 575 588 N/A INTRINSIC
ZnF_C2H2 593 615 3.78e-1 SMART
ZnF_C2H2 621 643 2.27e-4 SMART
ZnF_C2H2 649 671 8.02e-5 SMART
ZnF_C2H2 677 699 3.63e-3 SMART
ZnF_C2H2 705 727 3.11e-2 SMART
ZnF_C2H2 733 753 1.81e1 SMART
low complexity region 759 780 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218289
Predicted Effect noncoding transcript
Transcript: ENSMUST00000218743
Predicted Effect probably benign
Transcript: ENSMUST00000218969
Predicted Effect noncoding transcript
Transcript: ENSMUST00000219112
Predicted Effect probably benign
Transcript: ENSMUST00000219370
Predicted Effect probably benign
Transcript: ENSMUST00000220032
AA Change: V466A

PolyPhen 2 Score 0.001 (Sensitivity: 0.99; Specificity: 0.15)
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.9%
  • 20x: 93.8%
Validation Efficiency 92% (35/38)
MGI Phenotype FUNCTION: This gene encodes a member of the PR/SET family of zinc finger proteins. This protein has been shown to bind DNA in a sequence-specific manner and has been implicated in neural stem cell proliferation and differentiation. Pseudogenes have been identified on chromosomes 14 and X. Alternative splicing results in multiple transcript variants. [provided by RefSeq, Nov 2014]
PHENOTYPE: Mice homozygous for alleles lacking the zinc finger domain or PR/SET domain exhibit no abnormal phenotype. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 39 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4932415D10Rik A T 10: 82,296,037 S380T probably benign Het
Abcc6 T A 7: 45,981,057 I1260F probably damaging Het
Acat2 A G 17: 12,943,887 V358A probably benign Het
Adgrv1 G A 13: 81,487,962 A3476V possibly damaging Het
Akap13 A G 7: 75,579,768 N150D probably damaging Het
Asb2 G T 12: 103,345,684 Q60K probably benign Het
Asxl3 A T 18: 22,517,077 R708* probably null Het
Cd79b C T 11: 106,312,713 G116D probably damaging Het
Copg2 A G 6: 30,858,822 F218S probably benign Het
Defa5 A C 8: 21,297,588 E50D possibly damaging Het
Eva1c T A 16: 90,866,348 V91D probably damaging Het
Fosb T C 7: 19,309,358 Y25C probably damaging Het
Gm11639 T A 11: 104,999,281 probably null Het
Gm5141 G A 13: 62,774,387 H323Y probably damaging Het
Gpr19 T C 6: 134,870,435 N58S probably benign Het
Gpr26 G A 7: 131,984,164 A288T possibly damaging Het
Gucy2g T A 19: 55,241,028 Q70L probably damaging Het
Ifit2 C T 19: 34,573,497 R146* probably null Het
Lgr5 A C 10: 115,457,867 N408K possibly damaging Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Mief1 T A 15: 80,248,491 Y191* probably null Het
Npr3 C G 15: 11,905,432 A70P probably damaging Het
Olfr10 A T 11: 49,317,714 H56L probably damaging Het
Pcnt A G 10: 76,429,198 probably null Het
Pnlip A T 19: 58,671,742 D29V probably benign Het
Pnpt1 T A 11: 29,138,567 F277I possibly damaging Het
Pou2f2 A C 7: 25,093,581 V441G probably damaging Het
Ptprs A T 17: 56,422,195 V855E probably damaging Het
Rflna A G 5: 125,011,288 T100A probably benign Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Syn3 A G 10: 86,057,564 S472P unknown Het
Taar8a A T 10: 24,076,776 I93F possibly damaging Het
Taok2 T A 7: 126,878,758 D207V probably damaging Het
Tpst2 A T 5: 112,276,734 probably benign Homo
Trdv2-1 A G 14: 53,946,542 N77S possibly damaging Het
Wdr17 A C 8: 54,681,524 V18G probably benign Het
Zbtb17 T C 4: 141,464,950 V402A probably damaging Het
Zfp772 T C 7: 7,205,548 E99G possibly damaging Het
Zw10 A G 9: 49,069,626 D442G probably benign Het
Other mutations in Prdm4
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01864:Prdm4 APN 10 85893236 missense probably benign 0.08
IGL02514:Prdm4 APN 10 85907917 missense probably damaging 0.99
IGL02576:Prdm4 APN 10 85900937 missense possibly damaging 0.86
IGL02674:Prdm4 APN 10 85893399 missense probably damaging 0.99
IGL03002:Prdm4 APN 10 85893152 missense probably benign 0.08
IGL03153:Prdm4 APN 10 85907996 missense probably benign
IGL03278:Prdm4 APN 10 85907758 missense probably damaging 0.99
IGL03338:Prdm4 APN 10 85907821 missense possibly damaging 0.90
R0020:Prdm4 UTSW 10 85907623 missense probably benign
R0133:Prdm4 UTSW 10 85910221 critical splice donor site probably null
R0366:Prdm4 UTSW 10 85908004 missense probably damaging 1.00
R0633:Prdm4 UTSW 10 85907903 missense probably damaging 1.00
R1132:Prdm4 UTSW 10 85899281 missense probably damaging 1.00
R1460:Prdm4 UTSW 10 85907822 missense probably benign 0.28
R1477:Prdm4 UTSW 10 85904265 missense probably benign 0.00
R1680:Prdm4 UTSW 10 85899223 missense possibly damaging 0.96
R1772:Prdm4 UTSW 10 85893392 missense probably damaging 0.99
R1983:Prdm4 UTSW 10 85907953 missense probably damaging 1.00
R2136:Prdm4 UTSW 10 85893351 nonsense probably null
R3426:Prdm4 UTSW 10 85910289 missense probably damaging 1.00
R3723:Prdm4 UTSW 10 85899281 missense probably damaging 1.00
R4490:Prdm4 UTSW 10 85900899 missense probably damaging 1.00
R4750:Prdm4 UTSW 10 85899221 missense probably damaging 1.00
R5561:Prdm4 UTSW 10 85893123 makesense probably null
R5601:Prdm4 UTSW 10 85893123 makesense probably null
R5602:Prdm4 UTSW 10 85893123 makesense probably null
R5604:Prdm4 UTSW 10 85893123 makesense probably null
R5972:Prdm4 UTSW 10 85907501 missense probably damaging 1.00
R6272:Prdm4 UTSW 10 85907830 missense possibly damaging 0.82
R6300:Prdm4 UTSW 10 85910221 critical splice donor site probably null
R6457:Prdm4 UTSW 10 85908032 missense probably damaging 1.00
R6642:Prdm4 UTSW 10 85907818 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- CAAGTGCATTCTCAGGTCTAGC -3'
(R):5'- GTGAACATAAGATTCTTTGTCTGGG -3'

Sequencing Primer
(F):5'- CTCAGGTCTAGCTAATTTTGACTG -3'
(R):5'- GTTAAGCGCCTGTCTCAGTAG -3'
Posted On2018-06-22