Incidental Mutation 'R6639:Ift74'
ID525648
Institutional Source Beutler Lab
Gene Symbol Ift74
Ensembl Gene ENSMUSG00000028576
Gene Nameintraflagellar transport 74
SynonymsCmg1, 1700029H06Rik, Ccdc2, b2b796Clo
MMRRC Submission
Accession Numbers

NCBI RefSeq: NM_026319.2; MGI: 1914944

Is this an essential gene? Possibly essential (E-score: 0.551) question?
Stock #R6639 (G1)
Quality Score225.009
Status Validated
Chromosome4
Chromosomal Location94614491-94693229 bp(+) (GRCm38)
Type of Mutationintron
DNA Base Change (assembly) T to A at 94664259 bp
ZygosityHeterozygous
Amino Acid Change
Ref Sequence ENSEMBL: ENSMUSP00000030311 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000030311] [ENSMUST00000107104]
Predicted Effect probably benign
Transcript: ENSMUST00000030311
SMART Domains Protein: ENSMUSP00000030311
Gene: ENSMUSG00000028576

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 382 N/A INTRINSIC
coiled coil region 430 490 N/A INTRINSIC
coiled coil region 512 546 N/A INTRINSIC
Predicted Effect noncoding transcript
Transcript: ENSMUST00000104728
Predicted Effect unknown
Transcript: ENSMUST00000107104
AA Change: N366K
SMART Domains Protein: ENSMUSP00000102721
Gene: ENSMUSG00000028576
AA Change: N366K

DomainStartEndE-ValueType
low complexity region 22 33 N/A INTRINSIC
low complexity region 47 62 N/A INTRINSIC
coiled coil region 98 271 N/A INTRINSIC
coiled coil region 302 352 N/A INTRINSIC
Meta Mutation Damage Score 0.0516 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.5%
  • 20x: 92.1%
Validation Efficiency 100% (34/34)
MGI Phenotype PHENOTYPE: Mice homozygous for an ENU-induced mutation exhibit complex congenital heart disease associated with heterotaxy. [provided by MGI curators]
Allele List at MGI

All alleles(23) : Targeted(2) Gene trapped(21)

Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
4930452B06Rik A G 14: 8,536,530 S226P probably benign Het
Adgb T G 10: 10,435,956 I238L possibly damaging Het
Ankrd33b T C 15: 31,297,672 Y313C probably damaging Het
Capn15 C T 17: 25,960,178 V940I probably benign Het
Cdh3 G C 8: 106,511,341 V56L probably benign Het
Cfap57 T C 4: 118,554,712 E1245G probably benign Het
Depdc7 C T 2: 104,724,753 D271N probably damaging Het
Dmtn T C 14: 70,617,430 D10G probably damaging Het
Dusp12 T C 1: 170,880,674 E158G probably damaging Het
Egf C T 3: 129,736,832 G227D probably benign Het
Epha1 C A 6: 42,365,935 E227* probably null Het
Fbxo40 A T 16: 36,970,575 C58S probably damaging Het
Focad A G 4: 88,278,242 T611A unknown Het
Fpr-rs4 C T 17: 18,022,132 Q134* probably null Het
Fsip2 G A 2: 82,983,227 D3297N possibly damaging Het
Garnl3 T C 2: 32,989,525 R930G possibly damaging Het
Hdac4 A T 1: 91,970,948 C695S probably damaging Het
Ier2 G A 8: 84,662,162 T197M probably benign Het
Kat6b A G 14: 21,517,494 D207G possibly damaging Het
Khdrbs2 A T 1: 32,467,862 R196* probably null Het
Naip6 C A 13: 100,300,401 S538I probably benign Het
Nrip1 G A 16: 76,293,995 Q225* probably null Het
Olfr114 A G 17: 37,589,931 C141R probably damaging Het
Olfr354 G A 2: 36,907,678 C244Y probably damaging Het
Pdrg1 T C 2: 153,015,271 E17G probably damaging Het
R3hdm1 GAA GAAA 1: 128,162,811 probably null Het
Rnf17 C T 14: 56,438,743 P354S probably benign Het
Sh3rf3 T A 10: 59,083,467 Y469N probably damaging Het
Thoc6 T A 17: 23,670,454 probably null Het
Tpm3 C G 3: 90,079,802 A24G probably damaging Het
Tuft1 T C 3: 94,632,623 M93V probably benign Het
Vmn1r22 T C 6: 57,900,714 I93V probably benign Het
Zfp383 T C 7: 29,914,727 S136P probably benign Het
Zfp748 T C 13: 67,542,905 K79E probably damaging Het
Other mutations in Ift74
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00944:Ift74 APN 4 94693022 missense probably damaging 1.00
IGL01534:Ift74 APN 4 94679944 missense probably benign 0.00
IGL01701:Ift74 APN 4 94662658 missense possibly damaging 0.94
IGL02155:Ift74 APN 4 94679251 missense probably benign
IGL02455:Ift74 APN 4 94635831 nonsense probably null
IGL02877:Ift74 APN 4 94624781 critical splice donor site probably null
IGL03389:Ift74 APN 4 94621912 missense possibly damaging 0.57
P0005:Ift74 UTSW 4 94662576 splice site probably benign
PIT4243001:Ift74 UTSW 4 94686904 missense possibly damaging 0.94
R0211:Ift74 UTSW 4 94679255 missense probably benign 0.05
R0211:Ift74 UTSW 4 94679255 missense probably benign 0.05
R1019:Ift74 UTSW 4 94635835 missense probably benign 0.20
R1240:Ift74 UTSW 4 94692937 splice site probably null
R1699:Ift74 UTSW 4 94685703 missense probably benign 0.09
R1937:Ift74 UTSW 4 94662646 missense probably benign 0.10
R2114:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2116:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2117:Ift74 UTSW 4 94627259 missense probably benign 0.00
R2181:Ift74 UTSW 4 94632714 missense probably damaging 0.98
R2680:Ift74 UTSW 4 94653028 missense probably damaging 1.00
R3434:Ift74 UTSW 4 94621852 critical splice acceptor site probably null
R3435:Ift74 UTSW 4 94621852 critical splice acceptor site probably null
R4080:Ift74 UTSW 4 94652912 splice site probably null
R4379:Ift74 UTSW 4 94679934 missense probably benign 0.00
R4777:Ift74 UTSW 4 94652997 missense probably benign 0.00
R5197:Ift74 UTSW 4 94662596 missense probably benign 0.00
R5934:Ift74 UTSW 4 94632734 missense probably benign
R5994:Ift74 UTSW 4 94691724 missense possibly damaging 0.86
R6781:Ift74 UTSW 4 94627302 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- TAGGCTCATAACAGTACTAAGGTC -3'
(R):5'- ATCCAAGGTAGGGATTACAAGTTC -3'

Sequencing Primer
(F):5'- GAATGGCTCAGTCACTTTAC -3'
(R):5'- GCTGAGAATCAATTGATGAGATCAC -3'
Posted On2018-06-22