Mutagenetix > Incidental Mutation

Incidental Mutation 'R6639:Rnf17'

525673

Institutional Source

Beutler Lab

Gene Symbol

Rnf17

Ensembl Gene

ENSMUSG00000000365

Gene Name

ring finger protein 17

Synonyms

MMIP-2

MMRRC Submission

044760-MU

Accession Numbers

Essential gene?

Possibly non essential (E-score: 0.494) question?

Stock #

R6639 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

56640107-56762489 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to T at 56676200 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Proline to Serine at position 354 (P354S)

Ref Sequence

ENSEMBL: ENSMUSP00000153222 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000095793] [ENSMUST00000223627]

AlphaFold

Q99MV7

Predicted Effect

probably benign
Transcript: ENSMUST00000095793
AA Change: P354S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

SMART Domains

Protein: ENSMUSP00000093469
Gene: ENSMUSG00000000365
AA Change: P354S

Domain	Start	End	E-Value	Type
Blast:RING	9	72	2e-15	BLAST
low complexity region	398	405	N/A	INTRINSIC
Pfam:TUDOR	440	522	8.2e-8	PFAM
TUDOR	750	807	4.32e-12	SMART
low complexity region	824	836	N/A	INTRINSIC
Blast:TUDOR	850	882	1e-8	BLAST
low complexity region	959	970	N/A	INTRINSIC
TUDOR	984	1042	1.29e-1	SMART
low complexity region	1128	1139	N/A	INTRINSIC
TUDOR	1245	1301	7.7e-9	SMART
low complexity region	1416	1430	N/A	INTRINSIC
TUDOR	1495	1554	1e-7	SMART

Predicted Effect

probably benign
Transcript: ENSMUST00000223627
AA Change: P354S

PolyPhen 2 Score 0.010 (Sensitivity: 0.96; Specificity: 0.77)

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000225361

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.5%
20x: 92.1%

Validation Efficiency

100% (34/34)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene is similar to a mouse gene that encodes a testis-specific protein containing a RING finger domain. Alternatively spliced transcript variants encoding different isoforms have been found. [provided by RefSeq, May 2010]
PHENOTYPE: Homozygous null mice display male infertility, azoospermia, arrest of spermatogenesis, and small testis. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 34 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adgb	T	G	10: 10,311,700 (GRCm39)	I238L	possibly damaging	Het
Ankrd33b	T	C	15: 31,297,818 (GRCm39)	Y313C	probably damaging	Het
Capn15	C	T	17: 26,179,152 (GRCm39)	V940I	probably benign	Het
Cdh3	G	C	8: 107,237,973 (GRCm39)	V56L	probably benign	Het
Cfap20dc	A	G	14: 8,536,530 (GRCm38)	S226P	probably benign	Het
Cfap57	T	C	4: 118,411,909 (GRCm39)	E1245G	probably benign	Het
Depdc7	C	T	2: 104,555,098 (GRCm39)	D271N	probably damaging	Het
Dmtn	T	C	14: 70,854,870 (GRCm39)	D10G	probably damaging	Het
Dusp12	T	C	1: 170,708,243 (GRCm39)	E158G	probably damaging	Het
Egf	C	T	3: 129,530,481 (GRCm39)	G227D	probably benign	Het
Epha1	C	A	6: 42,342,869 (GRCm39)	E227*	probably null	Het
Fbxo40	A	T	16: 36,790,937 (GRCm39)	C58S	probably damaging	Het
Focad	A	G	4: 88,196,479 (GRCm39)	T611A	unknown	Het
Fpr-rs4	C	T	17: 18,242,394 (GRCm39)	Q134*	probably null	Het
Fsip2	G	A	2: 82,813,571 (GRCm39)	D3297N	possibly damaging	Het
Garnl3	T	C	2: 32,879,537 (GRCm39)	R930G	possibly damaging	Het
Hdac4	A	T	1: 91,898,670 (GRCm39)	C695S	probably damaging	Het
Ier2	G	A	8: 85,388,791 (GRCm39)	T197M	probably benign	Het
Ift74	T	A	4: 94,552,496 (GRCm39)		probably benign	Het
Kat6b	A	G	14: 21,567,562 (GRCm39)	D207G	possibly damaging	Het
Khdrbs2	A	T	1: 32,506,943 (GRCm39)	R196*	probably null	Het
Naip6	C	A	13: 100,436,909 (GRCm39)	S538I	probably benign	Het
Nrip1	G	A	16: 76,090,883 (GRCm39)	Q225*	probably null	Het
Or14j3	A	G	17: 37,900,822 (GRCm39)	C141R	probably damaging	Het
Or1n2	G	A	2: 36,797,690 (GRCm39)	C244Y	probably damaging	Het
Pdrg1	T	C	2: 152,857,191 (GRCm39)	E17G	probably damaging	Het
R3hdm1	GAA	GAAA	1: 128,090,548 (GRCm39)		probably null	Het
Sh3rf3	T	A	10: 58,919,289 (GRCm39)	Y469N	probably damaging	Het
Thoc6	T	A	17: 23,889,428 (GRCm39)		probably null	Het
Tpm3	C	G	3: 89,987,109 (GRCm39)	A24G	probably damaging	Het
Tuft1	T	C	3: 94,539,930 (GRCm39)	M93V	probably benign	Het
Vmn1r22	T	C	6: 57,877,699 (GRCm39)	I93V	probably benign	Het
Zfp383	T	C	7: 29,614,152 (GRCm39)	S136P	probably benign	Het
Zfp748	T	C	13: 67,691,024 (GRCm39)	K79E	probably damaging	Het

Other mutations in Rnf17

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00586:Rnf17	APN	14	56,658,539 (GRCm39)	missense	probably damaging	0.99
IGL00717:Rnf17	APN	14	56,703,207 (GRCm39)	missense	probably benign	0.00
IGL00978:Rnf17	APN	14	56,749,728 (GRCm39)	missense	probably damaging	1.00
IGL01295:Rnf17	APN	14	56,700,521 (GRCm39)	nonsense	probably null
IGL01779:Rnf17	APN	14	56,699,520 (GRCm39)	missense	probably benign	0.06
IGL02132:Rnf17	APN	14	56,658,623 (GRCm39)	missense	probably benign	0.27
IGL02183:Rnf17	APN	14	56,745,325 (GRCm39)	missense	probably null	0.99
IGL02387:Rnf17	APN	14	56,738,044 (GRCm39)	missense	probably damaging	1.00
IGL02422:Rnf17	APN	14	56,719,592 (GRCm39)	missense	probably damaging	1.00
IGL03081:Rnf17	APN	14	56,671,828 (GRCm39)	missense	probably benign	0.03
IGL03269:Rnf17	APN	14	56,665,403 (GRCm39)	missense	possibly damaging	0.74
divest	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
Shed	UTSW	14	56,749,753 (GRCm39)	missense	probably damaging	1.00
R0046:Rnf17	UTSW	14	56,708,830 (GRCm39)	missense	probably damaging	1.00
R0046:Rnf17	UTSW	14	56,708,830 (GRCm39)	missense	probably damaging	1.00
R0089:Rnf17	UTSW	14	56,751,563 (GRCm39)	missense	probably damaging	1.00
R0189:Rnf17	UTSW	14	56,719,650 (GRCm39)	missense	probably null	1.00
R0243:Rnf17	UTSW	14	56,719,541 (GRCm39)	missense	possibly damaging	0.80
R0245:Rnf17	UTSW	14	56,676,066 (GRCm39)	missense	probably damaging	0.97
R0486:Rnf17	UTSW	14	56,751,632 (GRCm39)	missense	probably benign	0.43
R0554:Rnf17	UTSW	14	56,760,007 (GRCm39)	missense	probably damaging	1.00
R0840:Rnf17	UTSW	14	56,712,904 (GRCm39)	missense	probably damaging	1.00
R1169:Rnf17	UTSW	14	56,751,622 (GRCm39)	missense	possibly damaging	0.89
R1170:Rnf17	UTSW	14	56,663,088 (GRCm39)	missense	probably benign	0.10
R1200:Rnf17	UTSW	14	56,705,163 (GRCm39)	missense	probably benign	0.44
R1464:Rnf17	UTSW	14	56,699,368 (GRCm39)	missense	probably damaging	1.00
R1464:Rnf17	UTSW	14	56,699,368 (GRCm39)	missense	probably damaging	1.00
R1472:Rnf17	UTSW	14	56,665,436 (GRCm39)	missense	probably damaging	1.00
R1512:Rnf17	UTSW	14	56,705,243 (GRCm39)	missense	probably benign	0.01
R1605:Rnf17	UTSW	14	56,730,822 (GRCm39)	missense	probably damaging	1.00
R1778:Rnf17	UTSW	14	56,759,856 (GRCm39)	missense	probably damaging	0.99
R1791:Rnf17	UTSW	14	56,741,464 (GRCm39)	nonsense	probably null
R2015:Rnf17	UTSW	14	56,724,426 (GRCm39)	missense	probably benign	0.00
R2023:Rnf17	UTSW	14	56,669,036 (GRCm39)	missense	possibly damaging	0.59
R2086:Rnf17	UTSW	14	56,720,837 (GRCm39)	missense	probably damaging	0.98
R2130:Rnf17	UTSW	14	56,730,811 (GRCm39)	missense	probably damaging	1.00
R2309:Rnf17	UTSW	14	56,743,439 (GRCm39)	missense	possibly damaging	0.95
R3003:Rnf17	UTSW	14	56,738,004 (GRCm39)	missense	probably damaging	1.00
R3611:Rnf17	UTSW	14	56,705,197 (GRCm39)	missense	probably benign	0.43
R3847:Rnf17	UTSW	14	56,749,753 (GRCm39)	missense	probably damaging	1.00
R3848:Rnf17	UTSW	14	56,749,753 (GRCm39)	missense	probably damaging	1.00
R3849:Rnf17	UTSW	14	56,749,753 (GRCm39)	missense	probably damaging	1.00
R3850:Rnf17	UTSW	14	56,749,753 (GRCm39)	missense	probably damaging	1.00
R3872:Rnf17	UTSW	14	56,712,870 (GRCm39)	missense	possibly damaging	0.89
R3874:Rnf17	UTSW	14	56,712,870 (GRCm39)	missense	possibly damaging	0.89
R4021:Rnf17	UTSW	14	56,697,458 (GRCm39)	missense	probably damaging	0.98
R4022:Rnf17	UTSW	14	56,697,458 (GRCm39)	missense	probably damaging	0.98
R4790:Rnf17	UTSW	14	56,671,812 (GRCm39)	missense	probably damaging	1.00
R4951:Rnf17	UTSW	14	56,759,848 (GRCm39)	missense	probably benign	0.02
R5068:Rnf17	UTSW	14	56,743,385 (GRCm39)	missense	probably damaging	0.99
R5069:Rnf17	UTSW	14	56,743,385 (GRCm39)	missense	probably damaging	0.99
R5070:Rnf17	UTSW	14	56,743,385 (GRCm39)	missense	probably damaging	0.99
R5518:Rnf17	UTSW	14	56,719,590 (GRCm39)	missense	probably damaging	1.00
R5628:Rnf17	UTSW	14	56,724,409 (GRCm39)	splice site	probably null
R5712:Rnf17	UTSW	14	56,708,856 (GRCm39)	missense	probably benign	0.19
R5747:Rnf17	UTSW	14	56,703,276 (GRCm39)	critical splice donor site	probably null
R5869:Rnf17	UTSW	14	56,743,445 (GRCm39)	missense	possibly damaging	0.94
R6336:Rnf17	UTSW	14	56,658,626 (GRCm39)	splice site	probably null
R6626:Rnf17	UTSW	14	56,665,381 (GRCm39)	missense	possibly damaging	0.92
R6675:Rnf17	UTSW	14	56,697,432 (GRCm39)	missense	probably damaging	1.00
R6731:Rnf17	UTSW	14	56,761,807 (GRCm39)	missense	possibly damaging	0.93
R7062:Rnf17	UTSW	14	56,703,111 (GRCm39)	missense	probably benign	0.00
R7103:Rnf17	UTSW	14	56,708,763 (GRCm39)	missense	possibly damaging	0.63
R7144:Rnf17	UTSW	14	56,749,789 (GRCm39)	splice site	probably null
R7527:Rnf17	UTSW	14	56,753,895 (GRCm39)	missense	probably damaging	1.00
R7664:Rnf17	UTSW	14	56,676,335 (GRCm39)	missense	probably damaging	1.00
R7754:Rnf17	UTSW	14	56,699,529 (GRCm39)	critical splice donor site	probably null
R7772:Rnf17	UTSW	14	56,715,144 (GRCm39)	missense	probably benign	0.27
R8092:Rnf17	UTSW	14	56,724,479 (GRCm39)	missense	probably benign	0.00
R8150:Rnf17	UTSW	14	56,658,593 (GRCm39)	missense	probably benign	0.19
R8203:Rnf17	UTSW	14	56,705,179 (GRCm39)	missense	probably benign	0.17
R8320:Rnf17	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
R8321:Rnf17	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
R8379:Rnf17	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
R8380:Rnf17	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
R8381:Rnf17	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
R8382:Rnf17	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
R8383:Rnf17	UTSW	14	56,661,999 (GRCm39)	frame shift	probably null
R8799:Rnf17	UTSW	14	56,737,886 (GRCm39)	missense	probably damaging	1.00
R8850:Rnf17	UTSW	14	56,722,658 (GRCm39)	missense	probably damaging	1.00
R9212:Rnf17	UTSW	14	56,761,785 (GRCm39)	missense	probably damaging	1.00
R9276:Rnf17	UTSW	14	56,719,554 (GRCm39)	missense	probably damaging	1.00
R9300:Rnf17	UTSW	14	56,697,495 (GRCm39)	missense	possibly damaging	0.79
R9375:Rnf17	UTSW	14	56,719,579 (GRCm39)	missense	probably damaging	1.00
R9664:Rnf17	UTSW	14	56,722,636 (GRCm39)	missense	probably damaging	1.00
Z1177:Rnf17	UTSW	14	56,705,163 (GRCm39)	missense	possibly damaging	0.66

Predicted Primers

PCR Primer
(F):5'- GTCACACTGTCACTAACAAATGAG -3'
(R):5'- ACAGCATGTTTCTACTAAGCACATG -3'

Sequencing Primer
(F):5'- GTCACTAACAAATGAGCAAGAAATAG -3'
(R):5'- TATCACATCAGGGCTGGA -3'

Posted On

2018-06-22