Mutagenetix > Incidental Mutation

Incidental Mutation 'R6606:Chd4'

525680

Institutional Source

Beutler Lab

Gene Symbol

Chd4

Ensembl Gene

ENSMUSG00000063870

Gene Name

chromodomain helicase DNA binding protein 4

Synonyms

D6Ertd380e, 9530019N15Rik, Mi-2beta

MMRRC Submission

044729-MU

Accession Numbers

Essential gene?

Essential (E-score: 1.000) question?

Stock #

R6606 (G1)

Quality Score

225.009

Status

Validated

Chromosome

Chromosomal Location

125073144-125107554 bp(+) (GRCm39)

Type of Mutation

missense

DNA Base Change (assembly)

C to A at 125086389 bp (GRCm39)

Zygosity

Heterozygous

Amino Acid Change

Threonine to Lysine at position 963 (T963K)

Ref Sequence

ENSEMBL: ENSMUSP00000060054 (fasta)

Gene Model

predicted gene model for transcript(s): [ENSMUST00000056889] [ENSMUST00000112390] [ENSMUST00000112392] [ENSMUST00000124317]

AlphaFold

Q6PDQ2

Predicted Effect

probably damaging
Transcript: ENSMUST00000056889
AA Change: T963K

PolyPhen 2 Score 0.993 (Sensitivity: 0.70; Specificity: 0.97)

SMART Domains

Protein: ENSMUSP00000060054
Gene: ENSMUSG00000063870
AA Change: T963K

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
low complexity region	107	144	N/A	INTRINSIC
Pfam:CHDNT	156	210	7.7e-35	PFAM
low complexity region	217	249	N/A	INTRINSIC
low complexity region	271	291	N/A	INTRINSIC
low complexity region	296	318	N/A	INTRINSIC
low complexity region	321	347	N/A	INTRINSIC
PHD	365	408	7.17e-15	SMART
RING	366	407	7.46e-1	SMART
low complexity region	424	443	N/A	INTRINSIC
PHD	444	487	4.41e-15	SMART
RING	445	486	2.63e0	SMART
CHROMO	492	572	8.11e-17	SMART
CHROMO	613	670	1.98e-11	SMART
low complexity region	675	694	N/A	INTRINSIC
DEXDc	715	927	2.73e-37	SMART
low complexity region	1044	1056	N/A	INTRINSIC
HELICc	1073	1157	7.61e-27	SMART
DUF1087	1282	1346	5.56e-33	SMART
DUF1086	1359	1516	4.05e-108	SMART
low complexity region	1526	1540	N/A	INTRINSIC
low complexity region	1560	1578	N/A	INTRINSIC
low complexity region	1590	1633	N/A	INTRINSIC
low complexity region	1635	1653	N/A	INTRINSIC
low complexity region	1661	1674	N/A	INTRINSIC
Pfam:CHDCT2	1727	1899	1.9e-98	PFAM
low complexity region	1903	1915	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112390
AA Change: T970K

PolyPhen 2 Score 0.959 (Sensitivity: 0.78; Specificity: 0.95)

SMART Domains

Protein: ENSMUSP00000108009
Gene: ENSMUSG00000063870
AA Change: T970K

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	87	99	N/A	INTRINSIC
low complexity region	114	151	N/A	INTRINSIC
Pfam:CHDNT	164	217	2e-28	PFAM
low complexity region	224	256	N/A	INTRINSIC
low complexity region	278	298	N/A	INTRINSIC
low complexity region	303	325	N/A	INTRINSIC
low complexity region	328	354	N/A	INTRINSIC
PHD	372	415	7.17e-15	SMART
RING	373	414	7.46e-1	SMART
low complexity region	431	450	N/A	INTRINSIC
PHD	451	494	4.41e-15	SMART
RING	452	493	2.63e0	SMART
CHROMO	499	579	8.11e-17	SMART
CHROMO	620	677	1.98e-11	SMART
low complexity region	682	701	N/A	INTRINSIC
DEXDc	722	934	2.73e-37	SMART
low complexity region	1051	1063	N/A	INTRINSIC
HELICc	1080	1164	7.61e-27	SMART
DUF1087	1289	1353	5.56e-33	SMART
DUF1086	1366	1523	4.05e-108	SMART
low complexity region	1533	1547	N/A	INTRINSIC
low complexity region	1567	1585	N/A	INTRINSIC
low complexity region	1597	1640	N/A	INTRINSIC
low complexity region	1642	1660	N/A	INTRINSIC
low complexity region	1668	1681	N/A	INTRINSIC
Pfam:CHDCT2	1735	1906	4.3e-90	PFAM
low complexity region	1910	1922	N/A	INTRINSIC

Predicted Effect

probably damaging
Transcript: ENSMUST00000112392
AA Change: T950K

PolyPhen 2 Score 0.988 (Sensitivity: 0.73; Specificity: 0.96)

SMART Domains

Protein: ENSMUSP00000108011
Gene: ENSMUSG00000063870
AA Change: T950K

Domain	Start	End	E-Value	Type
low complexity region	29	45	N/A	INTRINSIC
low complexity region	49	69	N/A	INTRINSIC
low complexity region	80	92	N/A	INTRINSIC
low complexity region	107	144	N/A	INTRINSIC
Pfam:CHDNT	156	210	1.1e-34	PFAM
low complexity region	217	249	N/A	INTRINSIC
low complexity region	271	291	N/A	INTRINSIC
low complexity region	296	318	N/A	INTRINSIC
low complexity region	321	347	N/A	INTRINSIC
PHD	352	395	7.17e-15	SMART
RING	353	394	7.46e-1	SMART
low complexity region	411	430	N/A	INTRINSIC
PHD	431	474	4.41e-15	SMART
RING	432	473	2.63e0	SMART
CHROMO	479	559	8.11e-17	SMART
CHROMO	600	657	1.98e-11	SMART
low complexity region	662	681	N/A	INTRINSIC
DEXDc	702	914	2.73e-37	SMART
low complexity region	1031	1043	N/A	INTRINSIC
HELICc	1060	1144	7.61e-27	SMART
DUF1087	1269	1333	5.56e-33	SMART
DUF1086	1346	1503	4.05e-108	SMART
low complexity region	1513	1527	N/A	INTRINSIC
low complexity region	1547	1565	N/A	INTRINSIC
low complexity region	1577	1620	N/A	INTRINSIC
low complexity region	1622	1640	N/A	INTRINSIC
low complexity region	1648	1661	N/A	INTRINSIC
Pfam:CHDCT2	1714	1886	2.8e-98	PFAM
low complexity region	1890	1902	N/A	INTRINSIC

Predicted Effect

probably benign
Transcript: ENSMUST00000124317

SMART Domains

Protein: ENSMUSP00000120704
Gene: ENSMUSG00000063870

Domain	Start	End	E-Value	Type
PDB:3MWY\|W	1	137	2e-13	PDB
DUF1087	141	205	5.56e-33	SMART
low complexity region	209	221	N/A	INTRINSIC
DUF1086	246	403	4.05e-108	SMART
low complexity region	413	427	N/A	INTRINSIC

Predicted Effect

noncoding transcript
Transcript: ENSMUST00000138968

Meta Mutation Damage Score

0.6292

Coding Region Coverage

1x: 99.9%
3x: 99.5%
10x: 97.8%
20x: 93.5%

Validation Efficiency

100% (35/35)

MGI Phenotype

FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The product of this gene belongs to the SNF2/RAD54 helicase family. It represents the main component of the nucleosome remodeling and deacetylase complex and plays an important role in epigenetic transcriptional repression. Patients with dermatomyositis develop antibodies against this protein. Somatic mutations in this gene are associated with serous endometrial tumors. Alternative splicing results in multiple transcript variants encoding different isoforms. [provided by RefSeq, Jul 2014]
PHENOTYPE: Mice homozygous for a gene trapped allele exhibit embryonic lethality between E3.5 and E4.5, absent blastocoele failure of trophectoderm function and increased apoptosis in blastocysts. [provided by MGI curators]

Allele List at MGI

Other mutations in this stock

Total: 36 list
Gene	Ref	Var	Chr/Loc	Mutation	Predicted Effect	Zygosity
Adal	A	G	2: 120,980,769 (GRCm39)	E21G	probably damaging	Het
Ankk1	T	C	9: 49,327,646 (GRCm39)	Y511C	probably benign	Het
Atn1	G	A	6: 124,721,919 (GRCm39)		probably benign	Het
Ccnt2	C	A	1: 127,730,978 (GRCm39)	S618R	probably benign	Het
Ces4a	A	G	8: 105,876,010 (GRCm39)	N517S	possibly damaging	Het
Crlf1	A	G	8: 70,953,824 (GRCm39)	Y310C	probably damaging	Het
Cyyr1	A	G	16: 85,254,438 (GRCm39)	Y155H	probably benign	Het
Dnah3	A	T	7: 119,660,179 (GRCm39)	I831N	probably benign	Het
Dnah8	G	A	17: 30,967,542 (GRCm39)	D2585N	probably benign	Het
Echdc1	A	G	10: 29,189,711 (GRCm39)	I17V	probably benign	Het
Ephx4	G	T	5: 107,560,931 (GRCm39)	V28F	probably damaging	Het
Erich6	A	G	3: 58,523,921 (GRCm39)	I651T	probably damaging	Het
Fbln7	A	G	2: 128,719,296 (GRCm39)	Q31R	possibly damaging	Het
Fbxl17	A	G	17: 63,794,783 (GRCm39)	V433A	probably damaging	Het
Gm20449	T	C	7: 41,108,253 (GRCm39)	E39G	unknown	Het
Gprc5b	G	A	7: 118,583,296 (GRCm39)	P191L	probably benign	Het
Klhl1	T	C	14: 96,360,658 (GRCm39)	T731A	possibly damaging	Het
Myo3b	A	G	2: 70,062,829 (GRCm39)	D371G	possibly damaging	Het
Or10n1	G	A	9: 39,525,378 (GRCm39)	V172M	probably damaging	Het
P4ha3	G	T	7: 99,954,851 (GRCm39)	C303F	probably damaging	Het
Parp10	C	A	15: 76,124,308 (GRCm39)	V782L	possibly damaging	Het
Prpf40a	A	G	2: 53,041,763 (GRCm39)	S501P	probably damaging	Het
Ptpn3	A	T	4: 57,265,104 (GRCm39)		probably null	Het
Ptprz1	A	C	6: 23,002,500 (GRCm39)	H1530P	probably benign	Het
Rasa4	A	G	5: 136,132,801 (GRCm39)	K18E	probably damaging	Het
Rit1	A	G	3: 88,624,945 (GRCm39)	E48G	probably damaging	Het
Rnd2	C	T	11: 101,359,825 (GRCm39)	L57F	probably damaging	Het
Rspo3	C	T	10: 29,330,277 (GRCm39)	R228K	unknown	Het
Scai	A	T	2: 38,965,147 (GRCm39)	S566T	probably benign	Het
Scn4a	T	C	11: 106,218,899 (GRCm39)	E973G	probably benign	Het
Slc15a3	T	A	19: 10,826,046 (GRCm39)	F246I	possibly damaging	Het
Stfa3	T	C	16: 36,275,647 (GRCm39)	D27G	possibly damaging	Het
Uba5	T	C	9: 103,932,420 (GRCm39)	D181G	probably damaging	Het
Urb1	T	C	16: 90,607,156 (GRCm39)	T25A	probably benign	Het
Zbtb43	G	T	2: 33,345,066 (GRCm39)	S16Y	probably damaging	Het
Zyg11b	G	A	4: 108,093,286 (GRCm39)	A717V	probably benign	Het

Other mutations in Chd4

Allele	Source	Chr	Coord	Type	Predicted Effect	PPH Score
IGL00573:Chd4	APN	6	125,086,860 (GRCm39)	missense	probably damaging	1.00
IGL00917:Chd4	APN	6	125,081,909 (GRCm39)	missense	possibly damaging	0.95
IGL01088:Chd4	APN	6	125,099,431 (GRCm39)	unclassified	probably benign
IGL02005:Chd4	APN	6	125,105,779 (GRCm39)	missense	possibly damaging	0.71
IGL02405:Chd4	APN	6	125,074,190 (GRCm39)	missense	probably benign	0.06
IGL02707:Chd4	APN	6	125,085,730 (GRCm39)	missense	probably damaging	1.00
IGL02976:Chd4	APN	6	125,098,331 (GRCm39)	missense	probably damaging	1.00
IGL03001:Chd4	APN	6	125,078,529 (GRCm39)	missense	possibly damaging	0.93
FR4304:Chd4	UTSW	6	125,099,107 (GRCm39)	unclassified	probably benign
FR4589:Chd4	UTSW	6	125,099,102 (GRCm39)	unclassified	probably benign
FR4589:Chd4	UTSW	6	125,099,096 (GRCm39)	missense	probably benign	0.02
FR4737:Chd4	UTSW	6	125,099,094 (GRCm39)	unclassified	probably benign
FR4976:Chd4	UTSW	6	125,099,094 (GRCm39)	unclassified	probably benign
R0311:Chd4	UTSW	6	125,078,628 (GRCm39)	missense	probably benign	0.15
R0414:Chd4	UTSW	6	125,084,443 (GRCm39)	missense	probably damaging	1.00
R0647:Chd4	UTSW	6	125,086,086 (GRCm39)	missense	probably damaging	1.00
R0656:Chd4	UTSW	6	125,079,930 (GRCm39)	missense	probably damaging	0.98
R1342:Chd4	UTSW	6	125,074,151 (GRCm39)	missense	probably benign	0.40
R1651:Chd4	UTSW	6	125,100,547 (GRCm39)	missense	possibly damaging	0.92
R1850:Chd4	UTSW	6	125,098,619 (GRCm39)	missense	probably damaging	1.00
R2190:Chd4	UTSW	6	125,091,260 (GRCm39)	missense	probably benign	0.18
R2192:Chd4	UTSW	6	125,082,320 (GRCm39)	missense	probably damaging	0.99
R2858:Chd4	UTSW	6	125,081,849 (GRCm39)	missense	probably damaging	0.99
R3406:Chd4	UTSW	6	125,098,970 (GRCm39)	missense	probably benign	0.09
R3431:Chd4	UTSW	6	125,097,523 (GRCm39)	splice site	probably benign
R4330:Chd4	UTSW	6	125,078,565 (GRCm39)	missense	probably benign	0.29
R4394:Chd4	UTSW	6	125,098,581 (GRCm39)	missense	probably damaging	0.99
R4538:Chd4	UTSW	6	125,097,649 (GRCm39)	missense	probably damaging	0.99
R4664:Chd4	UTSW	6	125,078,465 (GRCm39)	missense	possibly damaging	0.58
R4805:Chd4	UTSW	6	125,105,908 (GRCm39)	missense	possibly damaging	0.86
R5050:Chd4	UTSW	6	125,084,443 (GRCm39)	missense	probably damaging	1.00
R5055:Chd4	UTSW	6	125,077,949 (GRCm39)	missense	possibly damaging	0.65
R5232:Chd4	UTSW	6	125,098,273 (GRCm39)	missense	probably damaging	1.00
R5314:Chd4	UTSW	6	125,077,551 (GRCm39)	missense	probably damaging	0.96
R5343:Chd4	UTSW	6	125,097,326 (GRCm39)	missense	probably damaging	1.00
R5502:Chd4	UTSW	6	125,082,239 (GRCm39)	missense	possibly damaging	0.83
R5613:Chd4	UTSW	6	125,097,509 (GRCm39)	missense	probably damaging	0.99
R6211:Chd4	UTSW	6	125,078,248 (GRCm39)	missense	possibly damaging	0.82
R6753:Chd4	UTSW	6	125,091,263 (GRCm39)	missense	probably benign	0.01
R6808:Chd4	UTSW	6	125,099,086 (GRCm39)	missense	possibly damaging	0.53
R6939:Chd4	UTSW	6	125,083,501 (GRCm39)	missense	probably damaging	0.99
R6968:Chd4	UTSW	6	125,085,281 (GRCm39)	missense	probably damaging	1.00
R6973:Chd4	UTSW	6	125,099,825 (GRCm39)	missense	possibly damaging	0.53
R6992:Chd4	UTSW	6	125,091,339 (GRCm39)	missense	probably benign	0.14
R7058:Chd4	UTSW	6	125,085,405 (GRCm39)	missense	possibly damaging	0.74
R7081:Chd4	UTSW	6	125,106,948 (GRCm39)	missense	unknown
R7253:Chd4	UTSW	6	125,083,555 (GRCm39)	splice site	probably null
R7423:Chd4	UTSW	6	125,105,822 (GRCm39)	missense	possibly damaging	0.92
R7535:Chd4	UTSW	6	125,105,836 (GRCm39)	missense	probably benign	0.32
R7566:Chd4	UTSW	6	125,078,866 (GRCm39)	missense	possibly damaging	0.86
R8053:Chd4	UTSW	6	125,105,779 (GRCm39)	nonsense	probably null
R8155:Chd4	UTSW	6	125,082,287 (GRCm39)	missense	probably benign	0.00
R8711:Chd4	UTSW	6	125,100,485 (GRCm39)	unclassified	probably benign
R8783:Chd4	UTSW	6	125,100,347 (GRCm39)	missense	possibly damaging	0.53
R9020:Chd4	UTSW	6	125,084,469 (GRCm39)	missense	probably damaging	1.00
R9093:Chd4	UTSW	6	125,090,974 (GRCm39)	missense	probably benign	0.13
R9417:Chd4	UTSW	6	125,097,688 (GRCm39)	missense	probably damaging	0.99
R9509:Chd4	UTSW	6	125,099,485 (GRCm39)	missense	possibly damaging	0.96
RF046:Chd4	UTSW	6	125,099,094 (GRCm39)	unclassified	probably benign
RF052:Chd4	UTSW	6	125,099,108 (GRCm39)	unclassified	probably benign
RF058:Chd4	UTSW	6	125,099,094 (GRCm39)	unclassified	probably benign
RF060:Chd4	UTSW	6	125,099,108 (GRCm39)	unclassified	probably benign
X0025:Chd4	UTSW	6	125,083,430 (GRCm39)	nonsense	probably null
X0027:Chd4	UTSW	6	125,079,127 (GRCm39)	missense	probably damaging	0.98
X0063:Chd4	UTSW	6	125,090,978 (GRCm39)	missense	probably damaging	1.00
Z1176:Chd4	UTSW	6	125,078,561 (GRCm39)	missense	probably benign	0.36
Z1176:Chd4	UTSW	6	125,077,823 (GRCm39)	missense	possibly damaging	0.93

Predicted Primers

PCR Primer
(F):5'- TGTTGCTAACTGGAACTCCG -3'
(R):5'- AGGTATCAGGTTCCTTCAGGC -3'

Sequencing Primer
(F):5'- GAGGAACTGTTTCATCTGCTCAAC -3'
(R):5'- GTTCCTTCAGGCCCCGC -3'

Posted On

2018-06-22