Incidental Mutation 'R6606:Gm20449'
ID525681
Institutional Source Beutler Lab
Gene Symbol Gm20449
Ensembl Gene ENSMUSG00000092592
Gene Namepredicted gene 20449
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.124) question?
Stock #R6606 (G1)
Quality Score225.009
Status Validated
Chromosome7
Chromosomal Location41399378-41499417 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 41458829 bp
ZygosityHeterozygous
Amino Acid Change Glutamic Acid to Glycine at position 39 (E39G)
Ref Sequence ENSEMBL: ENSMUSP00000092110 (fasta)
Predicted Effect unknown
Transcript: ENSMUST00000094532
AA Change: E39G
Meta Mutation Damage Score 0.0492 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.5%
  • 10x: 97.8%
  • 20x: 93.5%
Validation Efficiency 100% (35/35)
Allele List at MGI
Other mutations in this stock
Total: 36 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Adal A G 2: 121,150,288 E21G probably damaging Het
Ankk1 T C 9: 49,416,346 Y511C probably benign Het
Atn1 G A 6: 124,744,956 probably benign Het
Ccnt2 C A 1: 127,803,241 S618R probably benign Het
Ces4a A G 8: 105,149,378 N517S possibly damaging Het
Chd4 C A 6: 125,109,426 T963K probably damaging Het
Crlf1 A G 8: 70,501,174 Y310C probably damaging Het
Cyyr1 A G 16: 85,457,550 Y155H probably benign Het
Dnah3 A T 7: 120,060,956 I831N probably benign Het
Dnah8 G A 17: 30,748,568 D2585N probably benign Het
Echdc1 A G 10: 29,313,715 I17V probably benign Het
Ephx4 G T 5: 107,413,065 V28F probably damaging Het
Erich6 A G 3: 58,616,500 I651T probably damaging Het
Fbln7 A G 2: 128,877,376 Q31R possibly damaging Het
Fbxl17 A G 17: 63,487,788 V433A probably damaging Het
Gprc5b G A 7: 118,984,073 P191L probably benign Het
Klhl1 T C 14: 96,123,222 T731A possibly damaging Het
Myo3b A G 2: 70,232,485 D371G possibly damaging Het
Olfr148 G A 9: 39,614,082 V172M probably damaging Het
P4ha3 G T 7: 100,305,644 C303F probably damaging Het
Parp10 C A 15: 76,240,108 V782L possibly damaging Het
Prpf40a A G 2: 53,151,751 S501P probably damaging Het
Ptpn3 A T 4: 57,265,104 probably null Het
Ptprz1 A C 6: 23,002,501 H1530P probably benign Het
Rasa4 A G 5: 136,103,947 K18E probably damaging Het
Rit1 A G 3: 88,717,638 E48G probably damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rspo3 C T 10: 29,454,281 R228K unknown Het
Scai A T 2: 39,075,135 S566T probably benign Het
Scn4a T C 11: 106,328,073 E973G probably benign Het
Slc15a3 T A 19: 10,848,682 F246I possibly damaging Het
Stfa3 T C 16: 36,455,285 D27G possibly damaging Het
Uba5 T C 9: 104,055,221 D181G probably damaging Het
Urb1 T C 16: 90,810,268 T25A probably benign Het
Zbtb43 G T 2: 33,455,054 S16Y probably damaging Het
Zyg11b G A 4: 108,236,089 A717V probably benign Het
Predicted Primers PCR Primer
(F):5'- TTTCTGCACAAGACCATAGATCAC -3'
(R):5'- ACCTCTTGGTGTTCTGCAGC -3'

Sequencing Primer
(F):5'- CAAGACCATAGATCACTAGATAAAGC -3'
(R):5'- AGCTCTGCTCCAGGATAGTCAG -3'
Posted On2018-06-22