Incidental Mutation 'R6640:Gpx1'
ID 525726
Institutional Source Beutler Lab
Gene Symbol Gpx1
Ensembl Gene ENSMUSG00000063856
Gene Name glutathione peroxidase 1
Synonyms Gpx, cellular GPx, GSHPx-1, CGPx, GPx-1
MMRRC Submission 044761-MU
Accession Numbers
Essential gene? Non essential (E-score: 0.000) question?
Stock # R6640 (G1)
Quality Score 225.009
Status Validated
Chromosome 9
Chromosomal Location 108216279-108217541 bp(+) (GRCm39)
Type of Mutation missense
DNA Base Change (assembly) A to G at 108217295 bp (GRCm39)
Zygosity Heterozygous
Amino Acid Change Aspartic acid to Glycine at position 133 (D133G)
Ref Sequence ENSEMBL: ENSMUSP00000141279 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000007959] [ENSMUST00000082429] [ENSMUST00000191997] [ENSMUST00000193987] [ENSMUST00000194701]
AlphaFold no structure available at present
Predicted Effect probably benign
Transcript: ENSMUST00000007959
SMART Domains Protein: ENSMUSP00000007959
Gene: ENSMUSG00000007815

DomainStartEndE-ValueType
RHO 8 181 1.09e-134 SMART
Predicted Effect probably damaging
Transcript: ENSMUST00000082429
AA Change: D189G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000081010
Gene: ENSMUSG00000063856
AA Change: D189G

DomainStartEndE-ValueType
Pfam:GSHPx 14 128 5.6e-45 PFAM
Predicted Effect probably damaging
Transcript: ENSMUST00000191997
AA Change: D132G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000142257
Gene: ENSMUSG00000063856
AA Change: D132G

DomainStartEndE-ValueType
Pfam:GSHPx 1 71 3.2e-23 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192053
Predicted Effect noncoding transcript
Transcript: ENSMUST00000192401
Predicted Effect noncoding transcript
Transcript: ENSMUST00000193424
Predicted Effect probably damaging
Transcript: ENSMUST00000193987
AA Change: D133G

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000141279
Gene: ENSMUSG00000063856
AA Change: D133G

DomainStartEndE-ValueType
Pfam:GSHPx 1 72 6.1e-26 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000194701
SMART Domains Protein: ENSMUSP00000141967
Gene: ENSMUSG00000007815

DomainStartEndE-ValueType
RHO 8 165 8.9e-117 SMART
Meta Mutation Damage Score 0.6428 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: The protein encoded by this gene belongs to the glutathione peroxidase family, members of which catalyze the reduction of organic hydroperoxides and hydrogen peroxide (H2O2) by glutathione, and thereby protect cells against oxidative damage. Knockout mice lacking this gene are highly sensitive to oxidants, and develop mature cataracts due to damage to the eye lens nucleus. Other studies indicate that H2O2 is also essential for growth-factor mediated signal transduction, mitochondrial function, and maintenance of thiol redox-balance; therefore, by limiting H2O2 accumulation, glutathione peroxidases are also involved in modulating these processes. Several isozymes of this gene family exist in vertebrates, which vary in cellular location and substrate specificity. This isozyme is the most abundant, is ubiquitously expressed and localized in the cytoplasm, and whose preferred substrate is hydrogen peroxide. It is also a selenoprotein, containing the rare amino acid selenocysteine (Sec) at its active site. Sec is encoded by the UGA codon, which normally signals translation termination. The 3' UTRs of selenoprotein mRNAs contain a conserved stem-loop structure, designated the Sec insertion sequence (SECIS) element, that is necessary for the recognition of UGA as a Sec codon, rather than as a stop signal. Alternatively spliced transcript variants have been found for this gene. [provided by RefSeq, Jul 2016]
PHENOTYPE: Homozygotes for targeted null mutations show increased sensitivity to the oxidative stress agents paraquat and hydrogen peroxide and to ischemia/reperfusion and cold-induced brain injury. Mutants also show paradoxical bradykinin-induced vasoconstriction. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,530,248 (GRCm39) N936K probably benign Het
Abca2 A T 2: 25,337,015 (GRCm39) Y2318F possibly damaging Het
Aldh1b1 A G 4: 45,803,868 (GRCm39) T469A possibly damaging Het
Aoc1l1 A G 6: 48,954,605 (GRCm39) D581G probably benign Het
Ccdc136 A G 6: 29,412,959 (GRCm39) D382G possibly damaging Het
Dapk1 A G 13: 60,864,628 (GRCm39) K141E probably damaging Het
Dnah6 A T 6: 73,001,276 (GRCm39) W3973R probably damaging Het
Dock10 G T 1: 80,511,555 (GRCm39) S1518* probably null Het
Elovl5 C A 9: 77,887,195 (GRCm39) Y195* probably null Het
Fbxl21 T A 13: 56,684,822 (GRCm39) W309R probably damaging Het
Gm10801 C CGTG 2: 98,494,152 (GRCm39) probably null Het
Hoxd1 T A 2: 74,593,606 (GRCm39) V54E probably damaging Het
Kcnh3 T C 15: 99,139,649 (GRCm39) V876A probably benign Het
Klri2 G C 6: 129,709,158 (GRCm39) F231L probably benign Het
Mogat1 T G 1: 78,500,411 (GRCm39) S158R probably damaging Het
Myo1c C T 11: 75,562,461 (GRCm39) P918S probably benign Het
Or2ag13 T A 7: 106,313,247 (GRCm39) I214F probably damaging Het
Or8k16 T A 2: 85,520,279 (GRCm39) C169S probably damaging Het
Otog G A 7: 45,911,167 (GRCm39) A673T possibly damaging Het
Pigm T C 1: 172,205,254 (GRCm39) V330A probably damaging Het
Rab33b A G 3: 51,391,900 (GRCm39) T50A possibly damaging Het
Raver2 C T 4: 100,988,500 (GRCm39) P371L probably damaging Het
Rpl15-ps6 G T 15: 52,341,016 (GRCm39) noncoding transcript Het
Sh3rf2 T A 18: 42,234,705 (GRCm39) Y163N probably damaging Het
Slc1a1 T C 19: 28,871,970 (GRCm39) probably null Het
Slc6a18 T A 13: 73,812,401 (GRCm39) Y563F possibly damaging Het
Sp3 A G 2: 72,801,458 (GRCm39) L185P possibly damaging Het
Thbs2 T C 17: 14,893,630 (GRCm39) D850G possibly damaging Het
Tmem161b C A 13: 84,370,537 (GRCm39) probably benign Het
Tmtc2 T A 10: 105,409,610 (GRCm39) M1L probably benign Het
Trpm2 C T 10: 77,773,660 (GRCm39) R585Q probably benign Het
Trpm3 T A 19: 22,955,946 (GRCm39) I1126K probably damaging Het
Ugt1a6b A C 1: 88,035,516 (GRCm39) T285P probably benign Het
Vps13b A G 15: 35,617,842 (GRCm39) T1181A possibly damaging Het
Other mutations in Gpx1
AlleleSourceChrCoordTypePredicted EffectPPH Score
R1692:Gpx1 UTSW 9 108,216,674 (GRCm39) missense possibly damaging 0.95
R1833:Gpx1 UTSW 9 108,216,555 (GRCm39) missense possibly damaging 0.89
R3442:Gpx1 UTSW 9 108,216,549 (GRCm39) missense probably benign
R4864:Gpx1 UTSW 9 108,216,594 (GRCm39) missense probably benign 0.35
R6838:Gpx1 UTSW 9 108,217,139 (GRCm39) missense possibly damaging 0.94
Predicted Primers PCR Primer
(F):5'- TTACCTTCCTGCGGAATGCC -3'
(R):5'- TCATTAGGTGGAAAGGCATCGG -3'

Sequencing Primer
(F):5'- TGCGGAATGCCTTGCCAAC -3'
(R):5'- AATGGATGGGACCAGCGCC -3'
Posted On 2018-06-22