Incidental Mutation 'R6640:Slc6a18'
ID525738
Institutional Source Beutler Lab
Gene Symbol Slc6a18
Ensembl Gene ENSMUSG00000021612
Gene Namesolute carrier family 6 (neurotransmitter transporter), member 18
SynonymsXtrp2, D630001K16Rik, XT2
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6640 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location73661752-73678023 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 73664282 bp
ZygosityHeterozygous
Amino Acid Change Tyrosine to Phenylalanine at position 563 (Y563F)
Ref Sequence ENSEMBL: ENSMUSP00000152525 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000022105] [ENSMUST00000109679] [ENSMUST00000109680] [ENSMUST00000220650] [ENSMUST00000222029] [ENSMUST00000223026] [ENSMUST00000223074]
Predicted Effect probably benign
Transcript: ENSMUST00000022105
AA Change: T499S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000022105
Gene: ENSMUSG00000021612
AA Change: T499S

DomainStartEndE-ValueType
Pfam:SNF 17 593 2.1e-182 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000109679
AA Change: T509S

PolyPhen 2 Score 0.030 (Sensitivity: 0.95; Specificity: 0.82)
SMART Domains Protein: ENSMUSP00000105301
Gene: ENSMUSG00000021612
AA Change: T509S

DomainStartEndE-ValueType
Pfam:SNF 17 511 6.8e-164 PFAM
low complexity region 513 526 N/A INTRINSIC
Predicted Effect possibly damaging
Transcript: ENSMUST00000109680
AA Change: Y525F

PolyPhen 2 Score 0.855 (Sensitivity: 0.83; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000105302
Gene: ENSMUSG00000021612
AA Change: Y525F

DomainStartEndE-ValueType
Pfam:SNF 17 325 2.1e-126 PFAM
Pfam:SNF 392 555 9.1e-31 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000220650
AA Change: T471S

PolyPhen 2 Score 0.102 (Sensitivity: 0.93; Specificity: 0.86)
Predicted Effect probably benign
Transcript: ENSMUST00000220703
Predicted Effect possibly damaging
Transcript: ENSMUST00000222029
AA Change: Y563F

PolyPhen 2 Score 0.946 (Sensitivity: 0.80; Specificity: 0.95)
Predicted Effect probably benign
Transcript: ENSMUST00000223026
Predicted Effect possibly damaging
Transcript: ENSMUST00000223074
AA Change: Y553F

PolyPhen 2 Score 0.853 (Sensitivity: 0.83; Specificity: 0.93)
Meta Mutation Damage Score 0.12 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] The SLC6 family of proteins, which includes SLC6A18, act as specific transporters for neurotransmitters, amino acids, and osmolytes like betaine, taurine, and creatine. SLC6 proteins are sodium cotransporters that derive the energy for solute transport from the electrochemical gradient for sodium ions (Hoglund et al., 2005 [PubMed 16125675]).[supplied by OMIM, Apr 2010]
PHENOTYPE: Homozygous null mice are overtly normal but have increased blood pressure associated with impaired renal accumulation of glycine. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,553,285 N936K probably benign Het
Abca2 A T 2: 25,447,003 Y2318F possibly damaging Het
Aldh1b1 A G 4: 45,803,868 T469A possibly damaging Het
Ccdc136 A G 6: 29,412,960 D382G possibly damaging Het
Dapk1 A G 13: 60,716,814 K141E probably damaging Het
Dnah6 A T 6: 73,024,293 W3973R probably damaging Het
Dock10 G T 1: 80,533,838 S1518* probably null Het
Doxl2 A G 6: 48,977,671 D581G probably benign Het
Elovl5 C A 9: 77,979,913 Y195* probably null Het
Fbxl21 T A 13: 56,537,009 W309R probably damaging Het
Gm10020 G T 15: 52,477,620 noncoding transcript Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gpx1 A G 9: 108,340,096 D133G probably damaging Het
Hoxd1 T A 2: 74,763,262 V54E probably damaging Het
Kcnh3 T C 15: 99,241,768 V876A probably benign Het
Klri2 G C 6: 129,732,195 F231L probably benign Het
Mogat1 T G 1: 78,523,774 S158R probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1008 T A 2: 85,689,935 C169S probably damaging Het
Olfr695 T A 7: 106,714,040 I214F probably damaging Het
Otog G A 7: 46,261,743 A673T possibly damaging Het
Pigm T C 1: 172,377,687 V330A probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Raver2 C T 4: 101,131,303 P371L probably damaging Het
Sh3rf2 T A 18: 42,101,640 Y163N probably damaging Het
Slc1a1 T C 19: 28,894,570 probably null Het
Sp3 A G 2: 72,971,114 L185P possibly damaging Het
Thbs2 T C 17: 14,673,368 D850G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmtc2 T A 10: 105,573,749 M1L probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Trpm3 T A 19: 22,978,582 I1126K probably damaging Het
Ugt1a6b A C 1: 88,107,794 T285P probably benign Het
Vps13b A G 15: 35,617,696 T1181A possibly damaging Het
Other mutations in Slc6a18
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00498:Slc6a18 APN 13 73671719 missense possibly damaging 0.82
IGL01370:Slc6a18 APN 13 73667031 missense probably damaging 1.00
IGL01959:Slc6a18 APN 13 73677865 missense probably damaging 1.00
IGL02096:Slc6a18 APN 13 73672751 missense probably benign 0.05
IGL02147:Slc6a18 APN 13 73668162 missense probably damaging 0.97
IGL02167:Slc6a18 APN 13 73666472 critical splice acceptor site probably null
IGL02465:Slc6a18 APN 13 73677785 missense probably benign 0.11
IGL02548:Slc6a18 APN 13 73669995 missense probably damaging 1.00
IGL02720:Slc6a18 APN 13 73669968 missense probably benign 0.16
IGL03341:Slc6a18 APN 13 73677923 missense probably benign 0.07
R0011:Slc6a18 UTSW 13 73665619 missense possibly damaging 0.59
R0219:Slc6a18 UTSW 13 73674632 splice site probably null
R0884:Slc6a18 UTSW 13 73667037 missense probably damaging 1.00
R1019:Slc6a18 UTSW 13 73677879 missense probably damaging 1.00
R1610:Slc6a18 UTSW 13 73668225 missense probably benign 0.10
R1901:Slc6a18 UTSW 13 73670043 missense probably benign 0.39
R1969:Slc6a18 UTSW 13 73664189 missense possibly damaging 0.66
R2014:Slc6a18 UTSW 13 73675725 missense probably benign 0.02
R2445:Slc6a18 UTSW 13 73666752 nonsense probably null
R2504:Slc6a18 UTSW 13 73675806 missense probably benign 0.01
R3125:Slc6a18 UTSW 13 73677802 missense probably damaging 1.00
R4084:Slc6a18 UTSW 13 73667029 missense probably benign 0.39
R4571:Slc6a18 UTSW 13 73666370 missense possibly damaging 0.59
R4735:Slc6a18 UTSW 13 73666435 missense probably benign 0.42
R5032:Slc6a18 UTSW 13 73666323 missense probably damaging 1.00
R5859:Slc6a18 UTSW 13 73668159 missense probably benign 0.01
R6258:Slc6a18 UTSW 13 73670045 nonsense probably null
R6350:Slc6a18 UTSW 13 73677925 missense possibly damaging 0.80
R6370:Slc6a18 UTSW 13 73668159 missense probably benign 0.21
R6747:Slc6a18 UTSW 13 73677991 start gained probably benign
R7267:Slc6a18 UTSW 13 73671636 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- AATGAGGCTGCATCTGAGTG -3'
(R):5'- GAATCCATGTGCTCACTGTTG -3'

Sequencing Primer
(F):5'- TGCATCTGAGTGGGCACAG -3'
(R):5'- CTGTTGTTACAGGAAGGGTGTG -3'
Posted On2018-06-22