Incidental Mutation 'R6640:Kcnh3'
ID525746
Institutional Source Beutler Lab
Gene Symbol Kcnh3
Ensembl Gene ENSMUSG00000037579
Gene Namepotassium voltage-gated channel, subfamily H (eag-related), member 3
SynonymsElk2, Melk2, C030044P22Rik, ether a go-go like
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6640 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location99224861-99242817 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 99241768 bp
ZygosityHeterozygous
Amino Acid Change Valine to Alanine at position 876 (V876A)
Ref Sequence ENSEMBL: ENSMUSP00000040548 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000041190] [ENSMUST00000041415] [ENSMUST00000163506]
Predicted Effect probably benign
Transcript: ENSMUST00000041190
SMART Domains Protein: ENSMUSP00000043901
Gene: ENSMUSG00000037570

DomainStartEndE-ValueType
low complexity region 44 57 N/A INTRINSIC
low complexity region 81 113 N/A INTRINSIC
Pfam:MCRS_N 134 331 5.7e-98 PFAM
FHA 362 419 2.04e-6 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000041415
AA Change: V876A

PolyPhen 2 Score 0.078 (Sensitivity: 0.93; Specificity: 0.85)
SMART Domains Protein: ENSMUSP00000040548
Gene: ENSMUSG00000037579
AA Change: V876A

DomainStartEndE-ValueType
PAS 20 88 3.94e0 SMART
PAC 94 136 9.92e-6 SMART
low complexity region 148 159 N/A INTRINSIC
Pfam:Ion_trans 224 523 3.8e-34 PFAM
Pfam:Ion_trans_2 453 517 1e-12 PFAM
cNMP 593 708 2.04e-16 SMART
low complexity region 781 800 N/A INTRINSIC
low complexity region 857 872 N/A INTRINSIC
coiled coil region 886 918 N/A INTRINSIC
low complexity region 977 993 N/A INTRINSIC
low complexity region 1022 1035 N/A INTRINSIC
low complexity region 1054 1062 N/A INTRINSIC
Predicted Effect probably benign
Transcript: ENSMUST00000163506
SMART Domains Protein: ENSMUSP00000131407
Gene: ENSMUSG00000037570

DomainStartEndE-ValueType
low complexity region 31 44 N/A INTRINSIC
low complexity region 68 100 N/A INTRINSIC
Pfam:MCRS_N 121 318 2.4e-97 PFAM
FHA 349 406 2.04e-6 SMART
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229143
Predicted Effect probably benign
Transcript: ENSMUST00000229399
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229656
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230444
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230552
Predicted Effect noncoding transcript
Transcript: ENSMUST00000230973
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 97.9%
  • 20x: 93.6%
Validation Efficiency 97% (31/32)
MGI Phenotype FUNCTION: The protein encoded by this gene is a voltage-gated potassium channel alpha subunit predominantly expressed in the forebrain. An increase in cognitive function was observed when this gene was knocked out, while deletion of the gene resulted in hippocampal hyperexcitability and epilepsy. [provided by RefSeq, Sep 2015]
PHENOTYPE: Mice homozygous for a knock-out allele exhibit abnormal long term object recognition memory, spatial reference memory, spatial working memory, and long term potentiation. Mice homozygous for a different knock-out allele exhibit neuron hyperexcitability and seizures. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 34 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A2ml1 A T 6: 128,553,285 N936K probably benign Het
Abca2 A T 2: 25,447,003 Y2318F possibly damaging Het
Aldh1b1 A G 4: 45,803,868 T469A possibly damaging Het
Ccdc136 A G 6: 29,412,960 D382G possibly damaging Het
Dapk1 A G 13: 60,716,814 K141E probably damaging Het
Dnah6 A T 6: 73,024,293 W3973R probably damaging Het
Dock10 G T 1: 80,533,838 S1518* probably null Het
Doxl2 A G 6: 48,977,671 D581G probably benign Het
Elovl5 C A 9: 77,979,913 Y195* probably null Het
Fbxl21 T A 13: 56,537,009 W309R probably damaging Het
Gm10020 G T 15: 52,477,620 noncoding transcript Het
Gm10801 C CGTG 2: 98,663,807 probably null Het
Gpx1 A G 9: 108,340,096 D133G probably damaging Het
Hoxd1 T A 2: 74,763,262 V54E probably damaging Het
Klri2 G C 6: 129,732,195 F231L probably benign Het
Mogat1 T G 1: 78,523,774 S158R probably damaging Het
Myo1c C T 11: 75,671,635 P918S probably benign Het
Olfr1008 T A 2: 85,689,935 C169S probably damaging Het
Olfr695 T A 7: 106,714,040 I214F probably damaging Het
Otog G A 7: 46,261,743 A673T possibly damaging Het
Pigm T C 1: 172,377,687 V330A probably damaging Het
Rab33b A G 3: 51,484,479 T50A possibly damaging Het
Raver2 C T 4: 101,131,303 P371L probably damaging Het
Sh3rf2 T A 18: 42,101,640 Y163N probably damaging Het
Slc1a1 T C 19: 28,894,570 probably null Het
Slc6a18 T A 13: 73,664,282 Y563F possibly damaging Het
Sp3 A G 2: 72,971,114 L185P possibly damaging Het
Thbs2 T C 17: 14,673,368 D850G possibly damaging Het
Tmem161b C A 13: 84,222,418 probably benign Het
Tmtc2 T A 10: 105,573,749 M1L probably benign Het
Trpm2 C T 10: 77,937,826 R585Q probably benign Het
Trpm3 T A 19: 22,978,582 I1126K probably damaging Het
Ugt1a6b A C 1: 88,107,794 T285P probably benign Het
Vps13b A G 15: 35,617,696 T1181A possibly damaging Het
Other mutations in Kcnh3
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Kcnh3 APN 15 99242473 missense possibly damaging 0.85
IGL00911:Kcnh3 APN 15 99233001 nonsense probably null
IGL01099:Kcnh3 APN 15 99239736 missense probably benign 0.02
IGL01350:Kcnh3 APN 15 99241992 missense probably benign
IGL01375:Kcnh3 APN 15 99226993 nonsense probably null
IGL01611:Kcnh3 APN 15 99229502 missense probably benign 0.04
IGL01920:Kcnh3 APN 15 99233377 missense probably benign 0.16
IGL02282:Kcnh3 APN 15 99228043 critical splice donor site probably null
IGL02581:Kcnh3 APN 15 99238171 missense possibly damaging 0.72
IGL02889:Kcnh3 APN 15 99227110 missense probably null 0.82
R0427:Kcnh3 UTSW 15 99233299 missense probably benign 0.22
R0532:Kcnh3 UTSW 15 99232963 missense probably damaging 1.00
R0538:Kcnh3 UTSW 15 99240958 missense probably benign 0.00
R0552:Kcnh3 UTSW 15 99229456 missense probably damaging 1.00
R1235:Kcnh3 UTSW 15 99242103 unclassified probably null
R1290:Kcnh3 UTSW 15 99227120 splice site probably null
R1499:Kcnh3 UTSW 15 99239915 missense probably benign 0.00
R1517:Kcnh3 UTSW 15 99238209 missense probably damaging 1.00
R1706:Kcnh3 UTSW 15 99238078 missense possibly damaging 0.86
R1973:Kcnh3 UTSW 15 99229400 missense probably damaging 1.00
R2285:Kcnh3 UTSW 15 99241992 missense probably benign
R3196:Kcnh3 UTSW 15 99233981 missense probably damaging 1.00
R3716:Kcnh3 UTSW 15 99232765 missense possibly damaging 0.52
R4619:Kcnh3 UTSW 15 99234101 missense probably damaging 1.00
R4620:Kcnh3 UTSW 15 99234101 missense probably damaging 1.00
R4624:Kcnh3 UTSW 15 99226372 missense probably damaging 1.00
R4701:Kcnh3 UTSW 15 99241945 missense probably benign
R4853:Kcnh3 UTSW 15 99242089 missense possibly damaging 0.56
R4869:Kcnh3 UTSW 15 99242032 missense probably benign 0.06
R4991:Kcnh3 UTSW 15 99232756 missense probably benign 0.00
R5004:Kcnh3 UTSW 15 99226502 nonsense probably null
R5296:Kcnh3 UTSW 15 99241939 missense probably null 0.92
R5317:Kcnh3 UTSW 15 99227941 missense probably benign
R5338:Kcnh3 UTSW 15 99242394 nonsense probably null
R5658:Kcnh3 UTSW 15 99242076 missense possibly damaging 0.77
R5794:Kcnh3 UTSW 15 99232974 missense probably benign 0.01
R5934:Kcnh3 UTSW 15 99226533 missense possibly damaging 0.46
R6303:Kcnh3 UTSW 15 99227038 missense probably benign 0.37
R6304:Kcnh3 UTSW 15 99227038 missense probably benign 0.37
R6385:Kcnh3 UTSW 15 99227941 missense probably benign
R6466:Kcnh3 UTSW 15 99238243 missense probably damaging 1.00
R6879:Kcnh3 UTSW 15 99238167 missense probably damaging 1.00
R6984:Kcnh3 UTSW 15 99228552 missense probably benign 0.00
X0028:Kcnh3 UTSW 15 99242100 missense probably benign 0.01
Predicted Primers PCR Primer
(F):5'- TGCAGAGAGCTTCTTCCAGC -3'
(R):5'- TCAGACAGCTCCATCACCTTG -3'

Sequencing Primer
(F):5'- GACAGCAGTAGACTGTGTTACTC -3'
(R):5'- ACCTTGGGTGTGGGGGTAAG -3'
Posted On2018-06-22