Incidental Mutation 'R6607:Tmem26'
ID525747
Institutional Source Beutler Lab
Gene Symbol Tmem26
Ensembl Gene ENSMUSG00000060044
Gene Nametransmembrane protein 26
Synonyms
MMRRC Submission
Accession Numbers
Is this an essential gene? Possibly non essential (E-score: 0.411) question?
Stock #R6607 (G1)
Quality Score225.009
Status Validated
Chromosome10
Chromosomal Location68723646-68782650 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to A at 68778713 bp
ZygosityHeterozygous
Amino Acid Change Histidine to Glutamine at position 319 (H319Q)
Ref Sequence ENSEMBL: ENSMUSP00000079789 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000080995] [ENSMUST00000218918]
Predicted Effect probably benign
Transcript: ENSMUST00000080995
AA Change: H319Q

PolyPhen 2 Score 0.002 (Sensitivity: 0.99; Specificity: 0.30)
SMART Domains Protein: ENSMUSP00000079789
Gene: ENSMUSG00000060044
AA Change: H319Q

DomainStartEndE-ValueType
Pfam:Tmem26 3 304 5.6e-125 PFAM
Predicted Effect probably benign
Transcript: ENSMUST00000218918
Meta Mutation Damage Score 0.1172 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (27/28)
MGI Phenotype FUNCTION: [Summary is not available for the mouse gene. This summary is for the human ortholog.] This gene encodes a protein containing multiple transmembrane helices. It is a selective surface protein marker of brite/beige adipocytes, which may coexist with classical brown adipocytes in brown adipose tissue. Alternative splicing of this gene results in multiple transcript variants. [provided by RefSeq, Dec 2015]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,306 D92G possibly damaging Het
Ace A T 11: 105,972,377 H326L possibly damaging Het
Adtrp A G 13: 41,777,611 F167L probably benign Het
Agbl2 A G 2: 90,801,326 T343A probably damaging Het
Cacna1a A T 8: 84,579,492 I1290F probably damaging Het
Cdh4 G A 2: 179,874,096 V356I probably benign Het
Celsr1 A G 15: 85,963,285 V1417A probably benign Het
Ctbs A G 3: 146,457,373 D172G possibly damaging Het
Dnah5 A G 15: 28,445,200 T4161A possibly damaging Het
Dut A G 2: 125,256,867 D140G probably damaging Het
Ep400 T C 5: 110,683,314 D2162G unknown Het
Esyt2 G A 12: 116,368,740 D781N probably benign Het
Fam174b T C 7: 73,766,564 L135P probably damaging Het
Fbxo15 A T 18: 84,959,145 T106S possibly damaging Het
Foxq1 A G 13: 31,559,146 D77G possibly damaging Het
Gclm G A 3: 122,255,615 probably null Het
Gcn1l1 T A 5: 115,609,478 S1677T probably damaging Het
Hamp2 T A 7: 30,922,588 R59* probably null Het
Herc1 C T 9: 66,418,567 A1441V probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Rbks C T 5: 31,647,792 V243M possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc17a4 T C 13: 23,905,414 probably null Het
Slc29a1 A C 17: 45,588,927 probably null Het
Tenm2 A G 11: 36,063,775 probably null Het
Vmn1r203 A G 13: 22,524,721 Y224C probably benign Het
Vmn1r223 T C 13: 23,249,749 I171T probably damaging Het
Vmn2r101 T C 17: 19,612,034 L764S probably damaging Het
Vmn2r84 T C 10: 130,390,862 H369R possibly damaging Het
Other mutations in Tmem26
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00155:Tmem26 APN 10 68775354 missense probably damaging 1.00
IGL00471:Tmem26 APN 10 68778681 missense possibly damaging 0.78
IGL01301:Tmem26 APN 10 68778606 missense probably damaging 1.00
IGL01567:Tmem26 APN 10 68751231 missense probably damaging 1.00
IGL02487:Tmem26 APN 10 68778733 missense probably benign 0.00
IGL02713:Tmem26 APN 10 68751295 missense probably damaging 1.00
IGL02828:Tmem26 APN 10 68775385 critical splice donor site probably null
ANU18:Tmem26 UTSW 10 68778606 missense probably damaging 1.00
P0027:Tmem26 UTSW 10 68778718 missense probably benign 0.00
R1415:Tmem26 UTSW 10 68778661 missense possibly damaging 0.93
R1649:Tmem26 UTSW 10 68751273 missense probably damaging 1.00
R3871:Tmem26 UTSW 10 68778732 missense probably benign 0.01
R5072:Tmem26 UTSW 10 68775348 missense probably damaging 1.00
R5239:Tmem26 UTSW 10 68751266 missense probably damaging 0.97
R6053:Tmem26 UTSW 10 68748484 missense probably benign 0.00
R6710:Tmem26 UTSW 10 68724054 missense probably damaging 1.00
T0722:Tmem26 UTSW 10 68778718 missense probably benign 0.00
X0003:Tmem26 UTSW 10 68778718 missense probably benign 0.00
Predicted Primers PCR Primer
(F):5'- TATGGGCCATTGGTCTCAGC -3'
(R):5'- ACTGGTGTATGCAAACATGGGG -3'

Sequencing Primer
(F):5'- AGCTTCTTCATCCAAGACGG -3'
(R):5'- CGAGTTAAGCCTCGCAGC -3'
Posted On2018-06-22