Incidental Mutation 'R6607:Esyt2'
ID525759
Institutional Source Beutler Lab
Gene Symbol Esyt2
Ensembl Gene ENSMUSG00000021171
Gene Nameextended synaptotagmin-like protein 2
Synonyms4921504I16Rik, D12Ertd551e, 2410017M09Rik, Fam62b
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6607 (G1)
Quality Score225.009
Status Validated
Chromosome12
Chromosomal Location116281196-116391050 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) G to A at 116368740 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Asparagine at position 781 (D781N)
Ref Sequence ENSEMBL: ENSMUSP00000152444 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000100986] [ENSMUST00000220720] [ENSMUST00000220816]
Predicted Effect probably benign
Transcript: ENSMUST00000100986
AA Change: D781N

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
SMART Domains Protein: ENSMUSP00000098548
Gene: ENSMUSG00000021171
AA Change: D781N

DomainStartEndE-ValueType
low complexity region 2 22 N/A INTRINSIC
transmembrane domain 51 73 N/A INTRINSIC
Pfam:SMP_LBD 115 294 3e-125 PFAM
C2 310 412 1.39e-14 SMART
C2 461 556 2.59e-14 SMART
low complexity region 660 669 N/A INTRINSIC
C2 726 831 5.51e-18 SMART
Predicted Effect probably benign
Transcript: ENSMUST00000220720
Predicted Effect probably benign
Transcript: ENSMUST00000220816
AA Change: D781N

PolyPhen 2 Score 0.180 (Sensitivity: 0.92; Specificity: 0.87)
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223150
Predicted Effect noncoding transcript
Transcript: ENSMUST00000223181
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (27/28)
MGI Phenotype PHENOTYPE: Mice are viable and fertile without overt morphological defects except reduced FGF-stimulated mouse embryonic fibroblast migration. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,306 D92G possibly damaging Het
Ace A T 11: 105,972,377 H326L possibly damaging Het
Adtrp A G 13: 41,777,611 F167L probably benign Het
Agbl2 A G 2: 90,801,326 T343A probably damaging Het
Cacna1a A T 8: 84,579,492 I1290F probably damaging Het
Cdh4 G A 2: 179,874,096 V356I probably benign Het
Celsr1 A G 15: 85,963,285 V1417A probably benign Het
Ctbs A G 3: 146,457,373 D172G possibly damaging Het
Dnah5 A G 15: 28,445,200 T4161A possibly damaging Het
Dut A G 2: 125,256,867 D140G probably damaging Het
Ep400 T C 5: 110,683,314 D2162G unknown Het
Fam174b T C 7: 73,766,564 L135P probably damaging Het
Fbxo15 A T 18: 84,959,145 T106S possibly damaging Het
Foxq1 A G 13: 31,559,146 D77G possibly damaging Het
Gclm G A 3: 122,255,615 probably null Het
Gcn1l1 T A 5: 115,609,478 S1677T probably damaging Het
Hamp2 T A 7: 30,922,588 R59* probably null Het
Herc1 C T 9: 66,418,567 A1441V probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Rbks C T 5: 31,647,792 V243M possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc17a4 T C 13: 23,905,414 probably null Het
Slc29a1 A C 17: 45,588,927 probably null Het
Tenm2 A G 11: 36,063,775 probably null Het
Tmem26 T A 10: 68,778,713 H319Q probably benign Het
Vmn1r203 A G 13: 22,524,721 Y224C probably benign Het
Vmn1r223 T C 13: 23,249,749 I171T probably damaging Het
Vmn2r101 T C 17: 19,612,034 L764S probably damaging Het
Vmn2r84 T C 10: 130,390,862 H369R possibly damaging Het
Other mutations in Esyt2
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00591:Esyt2 APN 12 116363444 missense probably damaging 1.00
IGL01636:Esyt2 APN 12 116365930 critical splice donor site probably null
IGL01912:Esyt2 APN 12 116339609 missense probably damaging 1.00
IGL02310:Esyt2 APN 12 116365921 missense probably benign 0.06
PIT4802001:Esyt2 UTSW 12 116365837 missense probably benign 0.00
R0134:Esyt2 UTSW 12 116367710 missense probably damaging 0.98
R0225:Esyt2 UTSW 12 116367710 missense probably damaging 0.98
R0313:Esyt2 UTSW 12 116347808 missense probably damaging 1.00
R0532:Esyt2 UTSW 12 116357198 splice site probably benign
R2324:Esyt2 UTSW 12 116367821 missense possibly damaging 0.50
R4610:Esyt2 UTSW 12 116318890 missense probably damaging 0.99
R4898:Esyt2 UTSW 12 116342088 missense probably benign 0.06
R4918:Esyt2 UTSW 12 116324140 missense probably benign 0.30
R5052:Esyt2 UTSW 12 116367796 missense probably damaging 1.00
R5222:Esyt2 UTSW 12 116318826 missense probably damaging 1.00
R5800:Esyt2 UTSW 12 116370188 missense possibly damaging 0.94
R6499:Esyt2 UTSW 12 116321170 missense probably damaging 0.98
R6951:Esyt2 UTSW 12 116324130 missense probably benign 0.21
R7153:Esyt2 UTSW 12 116346508 missense probably benign 0.00
R7173:Esyt2 UTSW 12 116363534 missense probably benign 0.05
R7227:Esyt2 UTSW 12 116342125 missense probably damaging 1.00
R7248:Esyt2 UTSW 12 116342238 missense probably damaging 1.00
Predicted Primers PCR Primer
(F):5'- ATCTGTTGGCCCAGTTCTG -3'
(R):5'- ATTAGAGTGAGCCTCCCTTCCC -3'

Sequencing Primer
(F):5'- AGTTCTGTTTCTTCCTTAGGGCAC -3'
(R):5'- GAGCCTCCCTTCCCACTATGTAAG -3'
Posted On2018-06-22