Incidental Mutation 'R6607:Vmn1r223'
ID525762
Institutional Source Beutler Lab
Gene Symbol Vmn1r223
Ensembl Gene ENSMUSG00000069280
Gene Namevomeronasal 1 receptor 223
SynonymsGm11330
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.050) question?
Stock #R6607 (G1)
Quality Score225.009
Status Validated
Chromosome13
Chromosomal Location23249238-23250323 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 23249749 bp
ZygosityHeterozygous
Amino Acid Change Isoleucine to Threonine at position 171 (I171T)
Ref Sequence ENSEMBL: ENSMUSP00000089312 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000091719]
Predicted Effect probably damaging
Transcript: ENSMUST00000091719
AA Change: I171T

PolyPhen 2 Score 1.000 (Sensitivity: 0.00; Specificity: 1.00)
SMART Domains Protein: ENSMUSP00000089312
Gene: ENSMUSG00000069280
AA Change: I171T

DomainStartEndE-ValueType
low complexity region 46 59 N/A INTRINSIC
Pfam:TAS2R 63 355 6.6e-10 PFAM
Pfam:V1R 94 357 2.1e-39 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (27/28)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,306 D92G possibly damaging Het
Ace A T 11: 105,972,377 H326L possibly damaging Het
Adtrp A G 13: 41,777,611 F167L probably benign Het
Agbl2 A G 2: 90,801,326 T343A probably damaging Het
Cacna1a A T 8: 84,579,492 I1290F probably damaging Het
Cdh4 G A 2: 179,874,096 V356I probably benign Het
Celsr1 A G 15: 85,963,285 V1417A probably benign Het
Ctbs A G 3: 146,457,373 D172G possibly damaging Het
Dnah5 A G 15: 28,445,200 T4161A possibly damaging Het
Dut A G 2: 125,256,867 D140G probably damaging Het
Ep400 T C 5: 110,683,314 D2162G unknown Het
Esyt2 G A 12: 116,368,740 D781N probably benign Het
Fam174b T C 7: 73,766,564 L135P probably damaging Het
Fbxo15 A T 18: 84,959,145 T106S possibly damaging Het
Foxq1 A G 13: 31,559,146 D77G possibly damaging Het
Gclm G A 3: 122,255,615 probably null Het
Gcn1l1 T A 5: 115,609,478 S1677T probably damaging Het
Hamp2 T A 7: 30,922,588 R59* probably null Het
Herc1 C T 9: 66,418,567 A1441V probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Rbks C T 5: 31,647,792 V243M possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc17a4 T C 13: 23,905,414 probably null Het
Slc29a1 A C 17: 45,588,927 probably null Het
Tenm2 A G 11: 36,063,775 probably null Het
Tmem26 T A 10: 68,778,713 H319Q probably benign Het
Vmn1r203 A G 13: 22,524,721 Y224C probably benign Het
Vmn2r101 T C 17: 19,612,034 L764S probably damaging Het
Vmn2r84 T C 10: 130,390,862 H369R possibly damaging Het
Other mutations in Vmn1r223
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL00661:Vmn1r223 APN 13 23250084 missense probably damaging 1.00
IGL01016:Vmn1r223 APN 13 23250067 missense probably damaging 1.00
IGL01353:Vmn1r223 APN 13 23249256 missense unknown
IGL01941:Vmn1r223 APN 13 23250237 missense possibly damaging 0.94
IGL02976:Vmn1r223 APN 13 23249995 missense probably damaging 1.00
IGL03064:Vmn1r223 APN 13 23249983 missense probably damaging 1.00
IGL03136:Vmn1r223 APN 13 23249763 missense possibly damaging 0.81
PIT4812001:Vmn1r223 UTSW 13 23249890 missense probably damaging 0.99
R1468:Vmn1r223 UTSW 13 23249868 missense possibly damaging 0.81
R1468:Vmn1r223 UTSW 13 23249868 missense possibly damaging 0.81
R1592:Vmn1r223 UTSW 13 23249667 missense possibly damaging 0.57
R1640:Vmn1r223 UTSW 13 23250178 missense probably damaging 1.00
R2116:Vmn1r223 UTSW 13 23249662 missense probably damaging 1.00
R3076:Vmn1r223 UTSW 13 23250165 missense probably benign 0.15
R4229:Vmn1r223 UTSW 13 23249415 missense probably benign 0.08
R4230:Vmn1r223 UTSW 13 23249415 missense probably benign 0.08
R5420:Vmn1r223 UTSW 13 23249505 missense probably benign 0.02
R6412:Vmn1r223 UTSW 13 23249655 missense probably benign 0.05
R6424:Vmn1r223 UTSW 13 23250175 missense probably damaging 1.00
R6944:Vmn1r223 UTSW 13 23249313 missense unknown
Predicted Primers PCR Primer
(F):5'- CCACTTGGCTTTTGTAAACACAATC -3'
(R):5'- GGAACAGCCACTTAACTGTGTG -3'

Sequencing Primer
(F):5'- CATTATTTATTGCATAGGGGTCAGAG -3'
(R):5'- TGCCTGGATGGTAGCATATAAC -3'
Posted On2018-06-22