Incidental Mutation 'R6607:A4galt'
ID525770
Institutional Source Beutler Lab
Gene Symbol A4galt
Ensembl Gene ENSMUSG00000047878
Gene Namealpha 1,4-galactosyltransferase
SynonymsGb3 synthase
MMRRC Submission
Accession Numbers
Is this an essential gene? Non essential (E-score: 0.000) question?
Stock #R6607 (G1)
Quality Score225.009
Status Validated
Chromosome15
Chromosomal Location83226722-83251774 bp(-) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 83228306 bp
ZygosityHeterozygous
Amino Acid Change Aspartic acid to Glycine at position 92 (D92G)
Ref Sequence ENSEMBL: ENSMUSP00000129719 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000049530] [ENSMUST00000164614] [ENSMUST00000229687]
Predicted Effect possibly damaging
Transcript: ENSMUST00000049530
AA Change: D92G

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000057999
Gene: ENSMUSG00000047878
AA Change: D92G

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:Gly_transf_sug 97 221 2.6e-30 PFAM
Pfam:Gb3_synth 228 355 2.3e-51 PFAM
Predicted Effect possibly damaging
Transcript: ENSMUST00000164614
AA Change: D92G

PolyPhen 2 Score 0.811 (Sensitivity: 0.84; Specificity: 0.93)
SMART Domains Protein: ENSMUSP00000129719
Gene: ENSMUSG00000047878
AA Change: D92G

DomainStartEndE-ValueType
transmembrane domain 31 53 N/A INTRINSIC
Pfam:Gly_transf_sug 97 221 2.6e-30 PFAM
Pfam:Gb3_synth 227 359 3.8e-52 PFAM
Predicted Effect noncoding transcript
Transcript: ENSMUST00000229454
Predicted Effect probably benign
Transcript: ENSMUST00000229687
Meta Mutation Damage Score 0.108 question?
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (27/28)
MGI Phenotype FUNCTION: The protein encoded by this gene catalyzes the transfer of galactose to lactosylceramide to form globotriaosylceramide, which has been identified as the P(k) antigen of the P blood group system. The encoded protein, which is a type II membrane protein found in the Golgi, is also required for the synthesis of the bacterial verotoxins receptor. Alternative splicing results in multiple transcript variants.[provided by RefSeq, Jan 2010]
PHENOTYPE: Homozygous null mice display reduced sensitivity to verotoxin but do not display any gross morphological abnormalities. [provided by MGI curators]
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
Ace A T 11: 105,972,377 H326L possibly damaging Het
Adtrp A G 13: 41,777,611 F167L probably benign Het
Agbl2 A G 2: 90,801,326 T343A probably damaging Het
Cacna1a A T 8: 84,579,492 I1290F probably damaging Het
Cdh4 G A 2: 179,874,096 V356I probably benign Het
Celsr1 A G 15: 85,963,285 V1417A probably benign Het
Ctbs A G 3: 146,457,373 D172G possibly damaging Het
Dnah5 A G 15: 28,445,200 T4161A possibly damaging Het
Dut A G 2: 125,256,867 D140G probably damaging Het
Ep400 T C 5: 110,683,314 D2162G unknown Het
Esyt2 G A 12: 116,368,740 D781N probably benign Het
Fam174b T C 7: 73,766,564 L135P probably damaging Het
Fbxo15 A T 18: 84,959,145 T106S possibly damaging Het
Foxq1 A G 13: 31,559,146 D77G possibly damaging Het
Gclm G A 3: 122,255,615 probably null Het
Gcn1l1 T A 5: 115,609,478 S1677T probably damaging Het
Hamp2 T A 7: 30,922,588 R59* probably null Het
Herc1 C T 9: 66,418,567 A1441V probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Rbks C T 5: 31,647,792 V243M possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc17a4 T C 13: 23,905,414 probably null Het
Slc29a1 A C 17: 45,588,927 probably null Het
Tenm2 A G 11: 36,063,775 probably null Het
Tmem26 T A 10: 68,778,713 H319Q probably benign Het
Vmn1r203 A G 13: 22,524,721 Y224C probably benign Het
Vmn1r223 T C 13: 23,249,749 I171T probably damaging Het
Vmn2r101 T C 17: 19,612,034 L764S probably damaging Het
Vmn2r84 T C 10: 130,390,862 H369R possibly damaging Het
Other mutations in A4galt
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01729:A4galt APN 15 83228325 missense probably damaging 0.99
IGL01827:A4galt APN 15 83227934 missense possibly damaging 0.52
IGL02745:A4galt APN 15 83228081 missense probably benign
IGL03201:A4galt APN 15 83228267 missense probably damaging 1.00
R0001:A4galt UTSW 15 83228289 missense probably benign 0.27
R0440:A4galt UTSW 15 83228493 missense probably damaging 0.98
R2763:A4galt UTSW 15 83227670 missense probably benign 0.03
R4331:A4galt UTSW 15 83227679 missense probably damaging 1.00
R4712:A4galt UTSW 15 83227609 missense probably damaging 1.00
R4941:A4galt UTSW 15 83228328 missense probably damaging 1.00
R6003:A4galt UTSW 15 83228111 missense probably benign 0.05
R6247:A4galt UTSW 15 83227819 missense probably damaging 0.99
Predicted Primers PCR Primer
(F):5'- GAGGTCGTATCCAGACATTAGG -3'
(R):5'- TGTTCCCATCTGGAGGAGAC -3'

Sequencing Primer
(F):5'- GTCGTATCCAGACATTAGGAAAAC -3'
(R):5'- ATCTGGAGGAGACCATGTCC -3'
Posted On2018-06-22