Incidental Mutation 'R6607:Vmn2r101'
ID525774
Institutional Source Beutler Lab
Gene Symbol Vmn2r101
Ensembl Gene ENSMUSG00000094892
Gene Namevomeronasal 2, receptor 101
SynonymsEG627576
MMRRC Submission
Accession Numbers
Is this an essential gene? Probably non essential (E-score: 0.108) question?
Stock #R6607 (G1)
Quality Score225.009
Status Validated
Chromosome17
Chromosomal Location19577231-19612317 bp(+) (GRCm38)
Type of Mutationmissense
DNA Base Change (assembly) T to C at 19612034 bp
ZygosityHeterozygous
Amino Acid Change Leucine to Serine at position 764 (L764S)
Ref Sequence ENSEMBL: ENSMUSP00000131583 (fasta)
Gene Model predicted gene model for transcript(s): [ENSMUST00000171914]
Predicted Effect probably damaging
Transcript: ENSMUST00000171914
AA Change: L764S

PolyPhen 2 Score 0.997 (Sensitivity: 0.41; Specificity: 0.98)
SMART Domains Protein: ENSMUSP00000131583
Gene: ENSMUSG00000094892
AA Change: L764S

DomainStartEndE-ValueType
signal peptide 1 19 N/A INTRINSIC
Pfam:ANF_receptor 82 466 1.6e-36 PFAM
Pfam:NCD3G 509 562 6.4e-22 PFAM
Pfam:7tm_3 595 830 1.4e-51 PFAM
Coding Region Coverage
  • 1x: 99.9%
  • 3x: 99.6%
  • 10x: 98.2%
  • 20x: 94.8%
Validation Efficiency 96% (27/28)
Allele List at MGI
Other mutations in this stock
Total: 30 list
GeneRefVarChr/LocMutationPredicted EffectZygosity
A4galt T C 15: 83,228,306 D92G possibly damaging Het
Ace A T 11: 105,972,377 H326L possibly damaging Het
Adtrp A G 13: 41,777,611 F167L probably benign Het
Agbl2 A G 2: 90,801,326 T343A probably damaging Het
Cacna1a A T 8: 84,579,492 I1290F probably damaging Het
Cdh4 G A 2: 179,874,096 V356I probably benign Het
Celsr1 A G 15: 85,963,285 V1417A probably benign Het
Ctbs A G 3: 146,457,373 D172G possibly damaging Het
Dnah5 A G 15: 28,445,200 T4161A possibly damaging Het
Dut A G 2: 125,256,867 D140G probably damaging Het
Ep400 T C 5: 110,683,314 D2162G unknown Het
Esyt2 G A 12: 116,368,740 D781N probably benign Het
Fam174b T C 7: 73,766,564 L135P probably damaging Het
Fbxo15 A T 18: 84,959,145 T106S possibly damaging Het
Foxq1 A G 13: 31,559,146 D77G possibly damaging Het
Gclm G A 3: 122,255,615 probably null Het
Gcn1l1 T A 5: 115,609,478 S1677T probably damaging Het
Hamp2 T A 7: 30,922,588 R59* probably null Het
Herc1 C T 9: 66,418,567 A1441V probably benign Het
Lrp1 G A 10: 127,560,136 H2422Y probably damaging Het
Rbks C T 5: 31,647,792 V243M possibly damaging Het
Rnd2 C T 11: 101,468,999 L57F probably damaging Het
Rsf1 CG CGACGGCGGTG 7: 97,579,908 probably benign Homo
Slc17a4 T C 13: 23,905,414 probably null Het
Slc29a1 A C 17: 45,588,927 probably null Het
Tenm2 A G 11: 36,063,775 probably null Het
Tmem26 T A 10: 68,778,713 H319Q probably benign Het
Vmn1r203 A G 13: 22,524,721 Y224C probably benign Het
Vmn1r223 T C 13: 23,249,749 I171T probably damaging Het
Vmn2r84 T C 10: 130,390,862 H369R possibly damaging Het
Other mutations in Vmn2r101
AlleleSourceChrCoordTypePredicted EffectPPH Score
IGL01121:Vmn2r101 APN 17 19589674 missense probably damaging 0.99
IGL02125:Vmn2r101 APN 17 19589701 missense possibly damaging 0.95
IGL02300:Vmn2r101 APN 17 19611937 missense probably damaging 1.00
IGL02682:Vmn2r101 APN 17 19612245 missense possibly damaging 0.82
IGL02825:Vmn2r101 APN 17 19589870 missense probably benign 0.00
IGL02862:Vmn2r101 APN 17 19611605 missense probably damaging 1.00
IGL02943:Vmn2r101 APN 17 19611404 missense probably damaging 0.99
R0371:Vmn2r101 UTSW 17 19590132 missense probably benign 0.07
R0462:Vmn2r101 UTSW 17 19590169 missense probably benign 0.04
R0492:Vmn2r101 UTSW 17 19588983 missense probably damaging 1.00
R0654:Vmn2r101 UTSW 17 19590111 missense probably benign 0.01
R1120:Vmn2r101 UTSW 17 19577461 splice site probably benign
R1323:Vmn2r101 UTSW 17 19612051 missense probably damaging 1.00
R1323:Vmn2r101 UTSW 17 19612051 missense probably damaging 1.00
R1676:Vmn2r101 UTSW 17 19611922 missense probably benign 0.00
R2023:Vmn2r101 UTSW 17 19590106 nonsense probably null
R2149:Vmn2r101 UTSW 17 19588963 missense probably benign 0.00
R2350:Vmn2r101 UTSW 17 19589783 missense probably benign 0.01
R2760:Vmn2r101 UTSW 17 19589639 missense probably benign 0.14
R3085:Vmn2r101 UTSW 17 19588815 splice site probably null
R3086:Vmn2r101 UTSW 17 19588815 splice site probably null
R3719:Vmn2r101 UTSW 17 19589549 missense possibly damaging 0.50
R3771:Vmn2r101 UTSW 17 19589657 missense probably benign
R3773:Vmn2r101 UTSW 17 19589657 missense probably benign
R4225:Vmn2r101 UTSW 17 19611689 missense probably damaging 1.00
R4248:Vmn2r101 UTSW 17 19589114 missense probably damaging 1.00
R4290:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4291:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4293:Vmn2r101 UTSW 17 19612041 missense probably damaging 1.00
R4307:Vmn2r101 UTSW 17 19590161 missense probably damaging 1.00
R4721:Vmn2r101 UTSW 17 19612025 missense probably damaging 0.99
R4829:Vmn2r101 UTSW 17 19611967 missense probably benign 0.03
R5022:Vmn2r101 UTSW 17 19611387 critical splice acceptor site probably null
R5110:Vmn2r101 UTSW 17 19611635 missense possibly damaging 0.92
R5244:Vmn2r101 UTSW 17 19611526 missense probably damaging 1.00
R5397:Vmn2r101 UTSW 17 19588842 missense probably damaging 1.00
R5875:Vmn2r101 UTSW 17 19588830 missense probably damaging 0.99
R5944:Vmn2r101 UTSW 17 19589507 missense probably benign 0.00
R6216:Vmn2r101 UTSW 17 19591005 missense probably benign 0.00
R6334:Vmn2r101 UTSW 17 19589850 missense possibly damaging 0.83
R6512:Vmn2r101 UTSW 17 19588884 missense probably damaging 1.00
R6965:Vmn2r101 UTSW 17 19591022 missense probably benign 0.00
R7101:Vmn2r101 UTSW 17 19589088 missense probably null 0.14
R7183:Vmn2r101 UTSW 17 19612178 missense probably damaging 1.00
R7344:Vmn2r101 UTSW 17 19611797 missense probably benign 0.38
R7375:Vmn2r101 UTSW 17 19611390 missense probably damaging 1.00
Z1088:Vmn2r101 UTSW 17 19588975 missense possibly damaging 0.78
Predicted Primers PCR Primer
(F):5'- TCAAGAGGTCCAAACTACATCATTC -3'
(R):5'- CACTTGGGTCCAAATATGAAGGC -3'

Sequencing Primer
(F):5'- GGTCCAAACTACATCATTCCTATATG -3'
(R):5'- TCCAAATATGAAGGCAAGGAGTG -3'
Posted On2018-06-22